Hello,

I am running for first time, installed via conda on Mint today. I get this error dump, which I think has something to do with the software not getting access to an expected config file:

after submitting:

.../TORMES$ tormes --metadata centmuts_metadata.txt --output TORMES_OUT1 --reference Ec_MG1655.fasta --threads 7 --genera Escherichia

"""
(maybe 30 or so of these...)
grep: /home/franklin/miniconda3/envs/tormes-1.1/bin/../files/config_file.txt: No such file or directory
grep: /home/franklin/miniconda3/envs/tormes-1.1/bin/../files/config_file.txt: No such file or directory
grep: /home/franklin/miniconda3/envs/tormes-1.1/bin/../files/config_file.txt: No such file or directory
/home/franklin/miniconda3/envs/tormes-1.1/bin/tormes: line 513: metadata.R: command not found
cut: reads.tmp: No such file or directory
Software: found

ERROR: Binaries for MAUVE not found! Please check if:
* Binaries are not installed
* Binaries are installed but the path in /home/franklin/miniconda3/envs/tormes-1.1/bin/../files/config_file.txt is incorrect

Was there another conda command needed? I can't see the error path to see where it's trying to look, but the tormes-1.1 folder and a bunch of stuff is in the miniconda3 directory.

Hi there,

I've been using TORMES for a little while now and have tried to scale this up for use on a HPC.

Sadly due to constraints, I am only allowed to use 12hrs of wall-time, this just about gets me through the Quality Filtering process for around 980 fastqs.

Would it be possible to incorporate a way of checkpoints, e.g. if TORMES detects that QC ha been completed, and all of the files are in the correct place, it can resume at a later stage when I resubmit the job?

Many thanks!
Steve

Hello,

I went through previous support questions but couldn't really find anything similar. After a lot of attempts I can't seem to get rid of the following conda issue. Conda is up-to-date and conda-clean was ran. There is no previous Tormes version either.

The following specifications were found to be incompatible with your system:

  - feature:/linux-64::__glibc==2.27=0
  - feature:|@/linux-64::__glibc==2.27=0
  - biopython=1.77 -> libgcc-ng[version='>=7.5.0'] -> __glibc[version='>=2.17']
  - blast=2.10.1 -> libgcc-ng[version='>=7.5.0'] -> __glibc[version='>=2.17']
  - fasttree=2.1.10 -> libgcc-ng[version='>=9.3.0'] -> __glibc[version='>=2.17']
  - git=2.28.0 -> libgcc-ng[version='>=7.5.0'] -> __glibc[version='>=2.17']
  - imagemagick=7.0.10_28 -> libgcc-ng[version='>=9.3.0'] -> __glibc[version='>=2.17']
  - kraken2=2.0.9beta -> libgcc-ng[version='>=7.3.0'] -> __glibc[version='>=2.17']
  - mauvealigner=1.2.0 -> libgcc-ng[version='>=9.3.0'] -> __glibc[version='>=2.17']
  - megahit=1.2.9 -> libgcc-ng[version='>=9.3.0'] -> __glibc[version='>=2.17']
  - python=3.6.11 -> libgcc-ng[version='>=9.3.0'] -> __glibc[version='>=2.17']
  - quast=5.0.2 -> libgcc-ng[version='>=9.3.0'] -> __glibc[version='>=2.17']
  - r-base=3.6.3 -> libgcc-ng[version='>=9.3.0'] -> __glibc[version='>=2.17']
  - r-stringi=1.4.6 -> libgcc-ng[version='>=7.5.0'] -> __glibc[version='>=2.17']
  - roary=3.13.0 -> libgcc-ng[version='>=7.3.0'] -> __glibc[version='>=2.17']
  - sickle-trim=1.33 -> libgcc-ng[version='>=9.3.0'] -> __glibc[version='>=2.17']
  - spades=3.15.2 -> libgcc-ng[version='>=9.3.0'] -> __glibc[version='>=2.17']
Your installed version is: 2.27

I don't understand what the problem is, it wants glibc > 2.17 and I have 2.27. Any pointers what I could do to solve this?

Thanks a lot!

Dear nmquijada,

I am having some issues with the installation of the package. When I try the commands for the installation using Conda, I get this output:

`(base) Pablos-MacBook-Air:~ pablovargas$ conda env create -n tormes-1.0 --file tormes-1.0.yml
WARNING: The conda.compat module is deprecated and will be removed in a future release.
WARNING: The conda.compat module is deprecated and will be removed in a future release.
Collecting package metadata: done
Solving environment: failed

ResolvePackageNotFound:

• libcurl==7.63.0=h01ee5af_1000
• jbig==2.1=h14c3975_2001
• openjpeg==2.3.0=hf38bd82_1003
• r-rcpp==0.12.18=r351h29659fb_0
• gdk-pixbuf==2.36.12=h4f1c04b_1001
• r-ttr==0.23_3=r351ha65eedd_0
• r-gower==0.1.2=r351h96ca727_0
• r-xml2==1.2.0=r351h29659fb_0
• r-kernsmooth==2.23_15=r351hac1494b_4
• r-randomforest==4.6_14=r351ha65eedd_0
• r-stringi==1.2.4=r351h29659fb_0
• libxcb==1.13=h14c3975_1002
• r-reprex==0.2.0=r351h6115d3f_0
• openjdk==11.0.1=h14c3975_1014
• r-lubridate==1.7.4=r351h29659fb_0
• graphite2==1.3.13=hf484d3e_1000
• xorg-libsm==1.2.3=h4937e3b_1000
• r-cluster==2.0.7_1=r351hac1494b_0
• r-reshape2==1.4.3=r351h29659fb_0
• r-rmarkdown==1.10=r351h6115d3f_0
• r-cellranger==1.1.0=r351h6115d3f_0
• py-boost==1.67.0=py35h04863e7_4
• libgenome==1.3.1=h470a237_0
• r-dimred==0.1.0=r351h6115d3f_0
• r-uuid==0.1_2=r351h96ca727_4
• gtk2==2.24.31=h5baeb44_1000
• libgfortran-ng==7.2.0=hdf63c60_3
• bzip2==1.0.6=h14c3975_1002
• r-codetools==0.2_15=r351h6115d3f_0
• r-modelmetrics==1.1.0=r351h29659fb_0
• r-testthat==2.0.0=r351h29659fb_0
• r-lazyeval==0.2.1=r351h96ca727_0
• r-dbi==1.0.0=r351h6115d3f_0
• mauve==2.4.0.r4736=0
• r-sourcetools==0.1.7=r351h29659fb_0
• libxml2==2.9.8=h143f9aa_1005
• ncurses==6.1=hf484d3e_1002
• r-formatr==1.5=r351h6115d3f_0
• sqlite==3.26.0=h67949de_1000
• pcre==8.41=hf484d3e_1003
• libuuid==2.32.1=h14c3975_1000
• r-mass==7.3_50=r351h96ca727_0
• r-foreach==1.4.4=r351h6115d3f_0
• r-scales==0.5.0=r351h29659fb_0
• r-praise==1.0.0=r351h6115d3f_4
• r-modelr==0.1.2=r351h6115d3f_0
• r-rprojroot==1.3_2=r351h6115d3f_0
• gmp==6.1.2=hf484d3e_1000
• r-plyr==1.8.4=r351h29659fb_0
• r-repr==0.15.0=r351h6115d3f_0
• r-readr==1.1.1=r351h29659fb_0
• xorg-libice==1.0.9=h14c3975_1004
• atk==2.25.90=hf2eb9ee_1001
• r-class==7.3_14=r351hd10c6a6_4
• pthread-stubs==0.4=h14c3975_1001
• r-bindr==0.1.1=r351h6115d3f_0
• r-forcats==0.3.0=r351h6115d3f_0
• r-rlang==0.2.1=r351h96ca727_0
• pango==1.40.14=hf0c64fd_1003
• r-magrittr==1.5=r351h6115d3f_4
• matplotlib==2.2.3=py35h8e2386c_0
• r-zoo==1.8_3=r351h96ca727_0
• xorg-xproto==7.0.31=h14c3975_1007
• ghostscript==9.22=hf484d3e_1001
• r-survival==2.42_6=r351h96ca727_0
• r-knitr==1.20=r351h6115d3f_0
• libgd==2.2.5=h0d07dcb_1005
• r-nlme==3.1_137=r351ha65eedd_0
• r-robustbase==0.93_2=r351ha65eedd_0
• xorg-libxt==1.1.5=h14c3975_1002
• r-data.table==1.11.4=r351h96ca727_0
• clustalw==2.1=h6bb024c_3
• r-callr==2.0.4=r351h6115d3f_0
• libffi==3.2.1=hf484d3e_1005
• xorg-kbproto==1.0.7=h14c3975_1002
• r-hexbin==1.27.2=r351ha65eedd_0
• r-bindrcpp==0.2.2=r351h29659fb_0
• gsl==2.2.1=h0c605f7_3
• graphviz==2.38.0=hcf1ce16_1009
• dbus==1.13.0=h4e0c4b3_1000
• qt==5.6.2=hbe13537_1012
• libssh2==1.8.0=h1ad7b7a_1003
• gettext==0.19.8.1=h9745a5d_1001
• r-tidyr==0.8.1=r351h29659fb_0
• r-promises==1.0.1=r351h29659fb_0
• xorg-libx11==1.6.7=h14c3975_1000
• blast==2.7.1=h4422958_6
• r-colorspace==1.3_2=r351h96ca727_0
• libedit==3.1.20170329=hf8c457e_1001
• r-caret==6.0_80=r351h96ca727_0
• harfbuzz==1.9.0=he243708_1001
• pytables==3.4.4=py35h4f72b40_1
• libtiff==4.0.10=h648cc4a_1001
• r-httpuv==1.4.5=r351h29659fb_0
• libtool==2.4.6=h14c3975_1002
• r-viridislite==0.3.0=r351h6115d3f_0
• r-kernlab==0.9_26=r351h80f5a37_0
• r-maps==3.3.0=r351h96ca727_0
• t_coffee==11.0.8=py35h075ee95_7
• numpy-base==1.15.2=py35h81de0dd_0
• r-glue==1.3.0=r351h96ca727_0
• r-markdown==0.8=r351h96ca727_0
• xorg-renderproto==0.11.1=h14c3975_1002
• quast==5.0.2=py35pl526ha92aebf_0
• r-digest==0.6.15=r351h96ca727_0
• r-recipes==0.1.3=r351h6115d3f_0
• xorg-xextproto==7.3.0=h14c3975_1002
• r-ipred==0.9_6=r351h96ca727_0
• r-prodlim==2018.04.18=r351h29659fb_0
• r-r6==2.2.2=r351h6115d3f_0
• perl==5.26.2=h14c3975_1001
• r-bh==1.66.0_1=r351h6115d3f_0
• r-irdisplay==0.5.0=r351h6115d3f_0
• r-readxl==1.1.0=r351h29659fb_0
• blosc==1.15.1=hf484d3e_1002
• r-xtable==1.8_2=r351h6115d3f_0
• cairo==1.14.12=h80bd089_1005
• r-shiny==1.1.0=r351h6115d3f_0
• r-spatial==7.3_11=r351hd10c6a6_4
• fontconfig==2.13.1=h2176d3f_1000
• r-lattice==0.20_35=r351h96ca727_0
• make==4.2.1=h14c3975_2004
• r-nnet==7.3_12=r351h96ca727_0
• r-crayon==1.3.4=r351h6115d3f_0
• bedtools==2.27.1=he860b03_3
• glib==2.56.2=had28632_1001
• r-iterators==1.0.10=r351h6115d3f_0
• giflib==5.1.4=h14c3975_1001
• r-mgcv==1.8_24=r351h96ca727_0
• r-curl==3.2=r351hadc6856_1
• r-xts==0.11_0=r351h96ca727_0
• r-rematch==1.0.1=r351h6115d3f_0
• xz==5.2.4=h14c3975_1001
• zlib==1.2.11=h14c3975_1004
• tormes==1.0=py35_0
• libsodium==1.0.16=h14c3975_1001
• r-deoptimr==1.0_8=r351h6115d3f_0
• r-stringr==1.3.1=r351h6115d3f_0
• r-base64enc==0.1_3=r351h96ca727_4
• perl-bio-tools-run-alignment-tcoffee==1.7.4=pl526_0
• r-rcolorbrewer==1.1_2=r351h6115d3f_0
• libmems==1.6.0=h470a237_1
• r-mime==0.5=r351h96ca727_0
• r-rvest==0.3.2=r351h6115d3f_0
• r-fansi==0.2.3=r351h96ca727_0
• r-rcpproll==0.3.0=r351h29659fb_0
• r-ape==5.1=r351h29659fb_1002
• xorg-libxext==1.3.3=h14c3975_1004
• r-plogr==0.2.0=r351h6115d3f_0
• libwebp==1.0.2=h576950b_1
• paml==4.9=h14c3975_4
• fftw==3.3.8=h14c3975_1001
• zeromq==4.2.5=hf484d3e_1006
• r-purrr==0.2.5=r351h96ca727_0
• r-ggplot2==3.0.0=r351h6115d3f_0
• r-utf8==1.1.4=r351h96ca727_0
• r-base==3.5.1=h391c2eb_5
• r-tidyverse==1.2.1=r351h6115d3f_0
• xorg-libxdmcp==1.1.2=h14c3975_1007
• libboost==1.67.0=h46d08c1_4
• pkg-config==0.29.2=h14c3975_1004
• r-labeling==0.3=r351h6115d3f_4
• r-clipr==0.4.1=r351h6115d3f_0
• r-processx==3.1.0=r351h29659fb_0
• tk==8.6.9=h84994c4_1000
• r-ddalpha==1.3.4=r351h80f5a37_0
• libxslt==1.1.32=h4785a14_1002
• r-later==0.7.3=r351h29659fb_0
• krb5==1.16.3=hc83ff2d_1000
• r-gtable==0.2.0=r351h6115d3f_0
• pixman==0.34.0=h14c3975_1003
• openssl==1.0.2p=h14c3975_0
• xorg-libxpm==3.5.12=h14c3975_1002
• expat==2.2.5=hf484d3e_1002
• aragorn==1.2.38=h470a237_2
• r-broom==0.5.0=r351h6115d3f_0
• r-rstudioapi==0.7=r351h6115d3f_0
• xorg-libxrender==0.9.10=h14c3975_1002
• r-xfun==0.3=r351h6115d3f_0
• libgcc==7.2.0=h69d50b8_2
• mauvealigner==1.2.0=hfc679d8_0
• r-tidyselect==0.2.4=r351h29659fb_0
• perl-pathtools==3.73=h470a237_2
• kraken==1.1=h470a237_2
• r-dplyr==0.7.6=r351h29659fb_0
• perl-statistics-basic==1.6611=pl526_2
• xorg-libxau==1.0.8=h14c3975_1006
• gstreamer==1.12.5=h0cc0488_1000
• r-munsell==0.5.0=r351h6115d3f_0
• r-haven==1.1.2=r351h29659fb_0
• libdb==6.1.26=hf484d3e_2000
• sistr_cmd==1.0.2=py35_0
• r-drr==0.0.3=r351h6115d3f_0
• r-pbdzmq==0.3_3=r351h29659fb_0
• numpy==1.15.2=py35h1d66e8a_0
• glimmerhmm==3.0.4=h2d50403_2
• r-foreign==0.8_71=r351h96ca727_0
• libpng==1.6.36=h84994c4_1000
• r-yaml==2.2.0=r351h96ca727_0
• r-pkgconfig==2.0.1=r351h6115d3f_0
• r-tinytex==0.6=r351h6115d3f_0
• readline==7.0=hf8c457e_1001
• r-matrix==1.2_14=r351h96ca727_0
• r-numderiv==2016.8_1=r351h6115d3f_0
• r-tibble==1.4.2=r351h96ca727_0
• libcroco==0.6.12=h468c787_1001
• r-backports==1.1.2=r351h96ca727_0
• r-rpart==4.1_13=r351hd10c6a6_0
• curl==7.63.0=h646f8bb_1000
• freetype==2.9.1=h94bbf69_1005
• lzo==2.10=h14c3975_1000
• libgcc-ng==7.3.0=hdf63c60_0
• r-jsonlite==1.5=r351h96ca727_0
• r-geometry==0.3_6=r351h96ca727_0
• jpeg==9c=h14c3975_1001
• r-pls==2.6_0=r351h6115d3f_0
• librsvg==2.40.19=h84fa2a2_1000
• r-glmnet==2.0_16=r351ha65eedd_0
• git==2.18.0=pl526hb37396a_0
• r-dichromat==2.0_0=r351h6115d3f_4
• r-htmltools==0.3.6=r351h29659fb_0
• r-highr==0.7=r351h6115d3f_0
• libiconv==1.15=h14c3975_1004
• r-openssl==1.0.2=r351h96ca727_0
• libstdcxx-ng==7.3.0=hdf63c60_0
• hmmer==3.2.1=hf484d3e_1
• r-lava==1.6.2=r351h6115d3f_0
• r-assertthat==0.2.0=r351h6115d3f_0
• icu==58.2=hf484d3e_1000
• r-squarem==2017.10_1=r351h6115d3f_0
• tktable==2.10=h14c3975_0

`

I am not sure what the problem is since this is the first time a package does not install. Perhaps it got something to do with the Conda version?

Thanks in advance for your support.

Cheers,
Pablo

Hello,

I am using Tormes 1.2 to type my E. coli genomes.

All the analyses were completed, e.g. resistance, statistics, point mutations, virulence ... etc. except fimH

When I looked at the log file:

(tormes-1.2.0) [ctsui@cdc1n2 ST131_Tormes]$ less tormes.log

            - Number of contigs in genome E55_S17: 92
            - Number of contigs in genome E59_S4: 104
            - Number of contigs in genome E64_S9: 115
            - Number of contigs in genome E70_S15: 142
            - Number of contigs in genome E82_S5: 104
            - Number of contigs in genome E85_S8: 118
            - Number of contigs in genome E87_S10: 145
            - Number of contigs in genome E97_S2: 76

Taxonomic identification started at: 2020-09-06 22:59

MLST started at: 2020-09-06 23:02

Antibiotic resistance and virulence genes search started at: 2020-09-06 23:02

Annotation started at: 2020-09-07 00:05
Serotyping started at: 2020-09-07 00:43

FimH typing started at: 2020-09-07 00:44
WARNING: FimH typing was not performed

Plasmid search started at: 2020-09-07 00:44

Point mutation search started at: 2020-09-07 00:44

Tormes report started at: 2020-09-07 00:50

TORMES pipeline finished at: 2020-09-07 00:51

Why fimH typing not perform? Any reasons?

Thanks,
Clement

Dear Narciso,
first of all, congratulations and a big thank you for developing this useful and handy pipeline. We have run the pipeline with several strains of E. coli (using the default settings, with no reference genome and option --genera Escherichia) but unfortunately we encountered several issues. To maintain one thread conversation for each query, I am going to create one issue for each question.

In Antibiotic resistance genes (ResFinder) count and Point mutations, we concluded that the error might be in the generation of the final report, as each tool seem to have worked well because individual expected results were generated. To correct this, we attempted to edit the Rmd (approx 3000 lines in R generated) as suggested in issue #2 however we have over 40 samples and find it a bit unreasonable to edit the lines for each samples. Perhaps you can suggest a more practical solution for this?

Please find attached these report files in the case you need them:

report_files.zip

Thanks in advance!

Hello, Narciso,

I have reads that I've filtered all 16s before and run tormes with these filtered reads. And seems that tormes couldn't create report file because 16S-rRNA folder Fasta files are empty. I'm not sure of this) Could it be so? I attached .err file.

Best regards,
Valery
87565_filt copy_err.txt

when I want to test tormes, it stop with this :
2020-04-24 17:08:56 - MEGAHIT v1.2.9
2020-04-24 17:08:56 - Using megahit_core with POPCNT and BMI2 support
Traceback (most recent call last):
File "/root/miniconda3/envs/tormes-1.1/bin/megahit", line 1038, in
main()
File "/root/miniconda3/envs/tormes-1.1/bin/megahit", line 988, in main
build_library()
File "/root/miniconda3/envs/tormes-1.1/bin/megahit", line 264, in checked_or_call
func(*args, **kwargs)
File "/root/miniconda3/envs/tormes-1.1/bin/megahit", line 723, in build_library
create_fifo('pe1', i, inpipe_cmd(opt.pe1[i]))
File "/root/miniconda3/envs/tormes-1.1/bin/megahit", line 710, in create_fifo
os.mkfifo(fifo_path)
PermissionError: [Errno 1] Operation not permitted

but all dependences are installed , megahit can pass selftest, whats the problem? Thanks

Dear Narciso,

Congratulations on the launch of the updated tormes pipeline. It's an excellent and valuable tool.

I have installed the new tormes-1.3.0 with no flags or errors during the installation. I've then run the pipeline on a few assembled genomes and it runs fine but it fails to create the .html report reporting error:" there is no package called ggtree".

I've un-installed, cleared conda and re-installed tormes but I keep getting the same error. Any ideas on why this might be?

I'm attaching a snip of the tormes.log file:

Hi Narciso,

I hope you are doing well and having a good time on whatever you are currently researching!
Still Tormes is fantastic, but I have a few quick questions...

Is there any reason in particular spades runs with 8 threads under the condition:
if [ "$ASSEMBLER" == 'spades' ]; then
if [ ${ASSEMBLYJOBS} -gt 1 ]; then
$PARALLEL -j ${ASSEMBLYJOBS} -a $OUTWD/list.tmp python $SPADES --careful -1 $OUTWD/cleaned_reads/{}.ok_1.fastq.gz -2 $OUTWD/cleaned_reads/{}.ok_2.fastq.gz -o $OUTWD/assembly/{}_assembly -t 8

Do you think it would be ok for me to change the code to put the thread variable read from the initial argument there?

Also, Java and progressivemauve seems to be spitting out a few errors. I was just wondering if you have any fixes for those? I have done some googling but cannot find much on the mauve. The java one has a few options to try, I have tried one but it didn't fix the issue.
Here is the output, I have attached the output file - the mauve and java errors start at line 1621.
progressiveMauve: symbol lookup error: /home/users/harbj019/.conda/envs/tormes-1.0/bin/../lib/libMems-1.6.so.1: undefined symbol: _ZN6genome21standardizePathStringERSs
Exited with error code: 127
Exception in thread "AWT-EventQueue-0" java.awt.HeadlessException:
No X11 DISPLAY variable was set, but this program performed an operation which requires it.
at java.awt.GraphicsEnvironment.checkHeadless(GraphicsEnvironment.java:204)
at java.awt.Window.(Window.java:536)
at java.awt.Frame.(Frame.java:420)
at java.awt.Frame.(Frame.java:385)
at javax.swing.SwingUtilities$SharedOwnerFrame.(SwingUtilities.java:1758)
at javax.swing.SwingUtilities.getSharedOwnerFrame(SwingUtilities.java:1833)
at javax.swing.JOptionPane.getRootFrame(JOptionPane.java:1696)
at javax.swing.JOptionPane.showOptionDialog(JOptionPane.java:863)
at javax.swing.JOptionPane.showMessageDialog(JOptionPane.java:666)
at javax.swing.JOptionPane.showMessageDialog(JOptionPane.java:637)
at org.gel.mauve.gui.AlignFrame.completeAlignment(Unknown Source)
at org.gel.mauve.gui.AlignWorker.finished(Unknown Source)
at org.gel.mauve.gui.SwingWorker$1.run(Unknown Source)
at java.awt.event.InvocationEvent.dispatch(InvocationEvent.java:311)
at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:762)
at java.awt.EventQueue.access$500(EventQueue.java:98)
at java.awt.EventQueue$3.run(EventQueue.java:715)
at java.awt.EventQueue$3.run(EventQueue.java:709)
at java.security.AccessController.doPrivileged(Native Method)
at java.security.ProtectionDomain$JavaSecurityAccessImpl.doIntersectionPrivilege(ProtectionDomain.java:80)
at java.awt.EventQueue.dispatchEvent(EventQueue.java:732)
at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:201)
at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:116)
at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:105)
at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:101)
at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:93)
at java.awt.EventDispatchThread.run(EventDispatchThread.

Thank you once again for such an awesome pipeline. Our lab is using it A LOT at the moment. We are all extremely grateful!

Cheers
Brad

tormesslurmout.txt

For tormes v1.3.0, tormes_setup should remove or overwrite existing tormes-setup-warnings.log in the same directory. As the setup currently runs, if there is a pre-existing tormes-setup-warnings.log with errors in it, it will say that the setup failed, even if everything completed successfully.

Hi Narciso,

The new release looks really good!!! I can't wait to try it out. However I was wondering if it would be possible to supply a (fasta) list of virulence genes of interest and a plasmid sequences of interest for the pipeline to focus on?

Cheers,
Pablo

ggtree installation returned an error message

* installing *source* package 'ggtree' ...
** using staged installation
** R
** inst
** byte-compile and prepare package for lazy loading
Error: object 'get_aes_var' is not exported by 'namespace:rvcheck'
Execution halted
ERROR: lazy loading failed for package 'ggtree'
* removing '/home/stevin/miniconda3/envs/tormes-1.3.0/lib/R/library/ggtree'

while running the following command in the installation procedure:

tormes-setup

This error seems to be related to a discussion on the Bioconductor Support forum

I could get ggtree to install successfully by adding the line

- r-rvcheck=0.1.8

to the 'dependencies' section of the tormes-1.3.0.yml file before creating conda environment using

conda env create -n tormes-1.3.0 --file tormes-1.3.0.yml

Hi,

I am trying to install tormes but when I use: conda env create -n tormes-1.3.0 --file tormes-1.3.0.yml, I get the following error:

Collecting package metadata (repodata.json): done
Solving environment: failed

ResolvePackageNotFound:

• ant=1.10.0
• mauvealigner=1.2.0
• tormes=1.3.0

I have updated conda but it has not resolved the issue. Any help much appreciated.

Thanks!

I have found a bug in tormes-report that makes the interactive report generation to fail when none of the samples included in the analysis resolves for a MLST scheme.
The bug has been fixed and will appear in the next version of TORMES.

In the mean time, if this is your case, you can check the output in the "mlst" directory (file "mlst.tab"). If none of the samples got a MLST scheme, just re-run TORMES by adding the --no_mlst option.

You can ispect the avaiable MLST schemes by typing mlst --list or mlst --longlist.

Sorry for the inconveniences,
Narciso

Hello, and congrats for the Tormes tool!
I encountered an issue installing it on WSL2. During the installation process everything seems fine, but when I run it, it shows the error you can see in the attached image file.
In the specified path there's no presence of the RDPTools folder, and of course the supposed classifier.jar inside of it.
I also tried to install RDPTools separetely but I get the same result.

Could you help me to solve this problem? Thank you so much in advance!

Silvano.

I'm excited about this tool. Thank you for making it! I have a three questions/comments:

1. I don't get an html file, and the error below seems to be from an attempt at report rendering. Do you have any suggestions?

Quitting from lines 192-201 (tormes_report.Rmd) 
Error in names(x) <- value : 
  'names' attribute [3] must be the same length as the vector [2]
Calls: <Anonymous> ... withCallingHandlers -> withVisible -> eval -> eval -> colnames<-
In addition: Warning messages:
1: package 'ggplot2' was built under R version 3.6.3 
2: package 'knitr' was built under R version 3.6.3 
3: package 'plotly' was built under R version 3.6.3 
4: package 'RColorBrewer' was built under R version 3.6.3 
5: package 'reshape2' was built under R version 3.6.3 
Execution halted

2. It seems that the input files must be in the same directory that tormes is run from.

3. Likewise, specifying an output directory isn't working. If I specify /directory1/directory2/myoutputdirectory, for some reason, the /directory1/directory2 part is pasted twice in the code, and it can't locate the correct directory, since it is looking for /directory1/directory2//directory1/directory2/myoutputdirectory. Here is an example snippet:

(tormes-1.1) [me@node0086 Applications]$ tormes --metadata metadata_AF054_003 --output /scratch3/me/AF054_003_Bacillus --threads 32 > tormes_stdout.txt &
[1] 4422
(tormes-1.1) [me@node0086 Applications]$ /home/me/anaconda3/envs/tormes-1.1/bin/tormes: line 672: /scratch3/me//scratch3/me/AF054_003_Bacillus/list.tmp: No such file or directory
tail: write error: Broken pipe
/home/me/anaconda3/envs/tormes-1.1/bin/tormes: line 674: /scratch3/me//scratch3/me/AF054_003_Bacillus/metadata.R: No such file or directory
...

The tormes output is suggesting that I use these two flags (--isolate --gene-finding). However, I can’t find any information regarding how to use them. I’m getting error messages when I try. Here is the command I’ m running:

ERROR: unknown option: --isolate

ERROR: unknown option: --gene-finding

Hi @nmquijada

I've developed a tool similar to TORMES, called Bactopia (https://github.com/bactopia/bactopia). I'm planning to submit a preprint very soon. In this preprint I make some comparisons to TORMES, if possible I'd like to get your feedback on my comparisons before submission.

Please feel free to contact me at [email protected] so that I can share our draft with you.

Thanks!
Robert

I previously assembled several genomes using Tormes 1.1, and around 128GB memory was sufficient. I'm trying to redo everything using Tormes 1.2, but even when I use 1500GB, spades throws a memory error, and spades.log reads:
": Error in malloc(): out of memory"

Do you have any insights into this or how I might parameterize tormes to get around this?

As an example, I am running the following:

qsub -I -q bigmem -l select=1:ncpus=8:mem=1500gb,walltime=72:00:00
cd /scratch1/dkarig/tormes1_2out
conda activate tormes-1.2.1
tormes --metadata metadata_AF054_003 --output AF054_003_Bacillus --threads 8 > tormes_stdout_Bacillus.txt &

Hello,

sorry but I don't clearly understand, what is the difference between folder assembly and genomes in output?
and one more question:
am I right that cleaned reads are only phred 33 and length 125, if there is no adapters?

Best regards,
Valery

Hello,
Thank you for the tool, it might be very useful for me. I have some errors during working, could you comment please.
{'serotypefinder': {'results': {'H_type': {'fliC_90_AY250023_H45': {'HSP_length': 1707,
'accession': 'AY250023',
'contig_name': 'NODE_32_length_68586_cov_83.397099',
'coverage': 100.0,
'gene': 'fliC',
'hit_id': 'NODE_32_length_68586_cov_83.397099:59707..61413:fliC_90_AY250023_H45:98.301113',
'identity': 98.3,
'position_in_ref': '1..1707',
'positions_in_contig': '59707..61413',
'serotype': 'H45',
'template_length': 1707}},
'O_type': {'wzx_72_DQ069297_O66': {'HSP_length': 1338,
'accession': 'DQ069297',
'contig_name': 'NODE_94_length_2903_cov_24.776657',
'coverage': 100.0,
'gene': 'wzx',
'hit_id': 'NODE_94_length_2903_cov_24.776657:293..1630:wzx_72_DQ069297_O66:99.925262',
'identity': 99.93,
'position_in_ref': '1..1338',
'positions_in_contig': '293..1630',
'serotype': 'O66',
'template_length': 1338},
'wzy_O59_DQ069297_O66': {'HSP_length': 923,
'accession': 'DQ069297',
'contig_name': 'NODE_89_length_3724_cov_21.140117',
'coverage': 72.92,
'gene': 'wzy',
'hit_id': 'NODE_89_length_3724_cov_21.140117:1..923:wzy_O59_DQ069297_O66:72.763605',
'identity': 99.78,
'position_in_ref': '49..969',
'positions_in_contig': '1..923',
'serotype': 'O66',
'template_length': 1263}}},
'run_info': {'date': '21.04.2020', 'time': '22:01:04'},
'user_input': {'file_format': 'fasta',
'filename(s)': ['/home/valery/bac11_rep/genomes/Sample1.fasta'],
'method': 'blast'}}}
Can't locate Bio/SeqIO.pm in @inc (you may need to install the Bio::SeqIO module) (@inc contains: /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.22.1 /usr/local/share/perl/5.22.1 /usr/lib/x86_64-linux-gnu/perl5/5.22 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.22 /usr/share/perl/5.22 /usr/local/lib/site_perl /usr/lib/x86_64-linux-gnu/perl-base .) at /home/valery/miniconda3/envs/tormes-1.1/bin/../CGE-modules/fimtyper/fimtyper.pl line 9.
BEGIN failed--compilation aborted at /home/valery/miniconda3/envs/tormes-1.1/bin/../CGE-modules/fimtyper/fimtyper.pl line 9.
sed: can't read /home/valery/bac11_rep/fimH_typing/Sample1/results_tab.txt: No such file or directory

Warning message:
package ‘rmarkdown’ was built under R version 3.6.2

processing file: tormes_report.Rmd
|. | 2%
ordinary text without R code

|... | 4%
label: unnamed-chunk-1 (with options)
List of 3
$ echo : logi FALSE
$ message: logi FALSE
$ warning: logi FALSE

Warning messages:
1: package 'ggplot2' was built under R version 3.6.2
2: package 'knitr' was built under R version 3.6.2
3: package 'plotly' was built under R version 3.6.3
4: package 'reshape2' was built under R version 3.6.3

Hello again,

Before running TORMES I concat reads as:
zcat name_L001.fastq.gz .. name_L004.fastq.gz > all_R1.fastq
Then I started pipeline with these reads and it hangs on
Quality filtering process started at: 2020-12-06 22:44
- Software for filtering chosen: prinseq
- Minimum quality of reads to survive: 25
- Minimum length of reads to survive: 125
There is no information about errors. How could it be so?

Best regards,
Valery

I am trying to install TORMES using the github release. Unfortunately the archives for version 1.2.1 only contain bin/version-1.2.0 and not bin/version 1.2.1.
Can you fix this?

Kind regards,

Fokke

Hello, here is the output of the fimH_typing.txt in my analysis:

CR18000822 FimH type - E.coli
CR18000822b FimH type - E.coli
ATCC25922one FimH type: fimH30
ATCC25922nor FimH type: fimH30

And all the 4 directories exist in the serotyping directory. However, when I inspect the tormes_report.html, the first result (CR18000822 FimH type - E.coli) is not included in the "Fim-H typing section".

Hi all,
not an issue, but thought I would share a script I wrote that auto-creates the samples_metadata file from the files you have in your folder and also adds the reference genome file to the arguments.
It then sftps your files over to a HPC (it is configured for the one at my university so you would need to change it). It also creates a 'slurm' job submission file to run tormes. Finally, it also creates a script to retrieve the files once you receive notification that tormes has finished.

It is my first script so it is probably a bit under optimised, but it gets the job done and the parts that parse the file names into an array and then puts them into the samples_metadata text file may come in handy for other people (that was the part that took me the longest!!!)

Cheers!
Brad
tormesbot.txt

Hi,
I have a problem with Tormes. When I work on fastq reads. When I start analysis all output files are moved by Tormes to rubbish and after in analysis I got a lot of information about "ERROR: could not find input file". In the end, I'm gotten empty folders without reports.
When I analyze the assembled genome in fasta format everything is ok.
I'm looking forward to your answer.

error-tormes.txt
chmod: changing permissions of 'metadata.R': Operation not permitted
Software: /opt/anaconda3/envs/tormes-1.1/bin/abricate found
Software: /opt/anaconda3/envs/tormes-1.1/bin/convert found
Software: /opt/anaconda3/envs/tormes-1.1/bin/fasttree found
Software: /opt/anaconda3/envs/tormes-1.1/bin/kraken found
Software: /opt/anaconda3/envs/tormes-1.1/bin/kraken-report found
Software: /opt/anaconda3/envs/tormes-1.1/bin/megahit found
Software: /opt/anaconda3/envs/tormes-1.1/bin/mlst found
Software: /opt/anaconda3/envs/tormes-1.1/bin/parallel found
Software: /opt/anaconda3/envs/tormes-1.1/bin/prinseq-lite.pl found
Software: /opt/anaconda3/envs/tormes-1.1/bin/prokka found
Software: /opt/anaconda3/envs/tormes-1.1/bin/quast found
Software: /opt/anaconda3/envs/tormes-1.1/bin/roary found
Software: /opt/anaconda3/envs/tormes-1.1/bin/roary2svg.pl found
Software: /opt/anaconda3/envs/tormes-1.1/bin/sickle found
Software: /opt/anaconda3/envs/tormes-1.1/bin/spades.py found
Software: /opt/anaconda3/envs/tormes-1.1/bin/trimmomatic found
Software: /opt/anaconda3/envs/tormes-1.1/bin/../share/mauve-*/Mauve.jar found
Binaries for MAUVE found
Software: /opt/anaconda3/envs/tormes-1.1/bin/../CGE-modules/fimtyper/fimtyper.pl found
Software: /opt/anaconda3/envs/tormes-1.1/bin/../CGE-modules/serotypefinder/serotypefinder.py found
Binaries for BLAST version 2.6 or later found
Software: /opt/anaconda3/envs/tormes-1.1/bin/../CGE-modules/pointfinder/PointFinder.py found
chmod: changing permissions of '/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/metadata.R': Operation not permitted

Thanks for using tormes version 1.1
Status can be seen in "/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/tormes.log"

cp: cannot stat 'a': No such file or directory

Some reads are not gzipped... Let's gzip for optimize speed!

gzip: /media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/Raw_reads/EC5_S11_L001_R2_001.fastq_R1.fastq.gz: Operation not permitted
gzip: /media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/Raw_reads/EC5_S11_L001_R2_001.fastq_R1.fastq.gz: Operation not permitted
TrimmomaticPE: Started with arguments:
-threads 20 -phred33 /media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/Raw_reads/EC5_S11_L001_R2_001.fastq_R1.fastq.gz /media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/Raw_reads/EC5_S11_L001_R2_001.fastq_R2.fastq.gz /media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/cleaned_reads/EC5_S11_L001_R2_001.fastq.noadapt.R1.fastq.gz /dev/null /media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/cleaned_reads/EC5_S11_L001_R2_001.fastq.noadapt.R2.fastq.gz /dev/null ILLUMINACLIP:/opt/anaconda3/envs/tormes-1.1/bin/../files/adapters.fasta:1:30:11
Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG'
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Skipping duplicate Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG'
Using Long Clipping Sequence: 'TTTTTTTTTTAATGATACGGCGACCACCGAGATCTACAC'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT'
Using Long Clipping Sequence: 'TTTTTTTTTTCAAGCAGAAGACGGCATACGA'
Skipping duplicate Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
Using Long Clipping Sequence: 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'
Using Long Clipping Sequence: 'CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA'
Using Long Clipping Sequence: 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT'
ILLUMINACLIP: Using 2 prefix pairs, 17 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Exception in thread "main" java.io.FileNotFoundException: /media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/Raw_reads/EC5_S11_L001_R2_001.fastq_R2.fastq.gz (No such file or directory)
at java.io.FileInputStream.open0(Native Method)
at java.io.FileInputStream.open(FileInputStream.java:195)
at java.io.FileInputStream.(FileInputStream.java:138)
at org.usadellab.trimmomatic.fastq.FastqParser.parse(FastqParser.java:135)
at org.usadellab.trimmomatic.TrimmomaticPE.process(TrimmomaticPE.java:268)
at org.usadellab.trimmomatic.TrimmomaticPE.run(TrimmomaticPE.java:555)
at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:80)
gzip: /media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/cleaned_reads/*gz.gz: No such file or directory

ERROR: could not find input file "/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/cleaned_reads/EC5_S11_L001_R2_001.fastq.noadapt.R1.fastq".

Try 'perl prinseq-lite.pl -h' for more information.
Exit program.
gzip: /media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/cleaned_reads/*fastq: No such file or directory
paste: /media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/temp1: No such file or directory
cut: /media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/kraken_summary.tmp: No such file or directory
cut: /media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/kraken_summary.tmp: No such file or directory
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/sedXvpZWW’: Operation not permitted
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/mlst/sedyrBS9Y’: Operation not permitted
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/mlst/sedIVgKa0’: Operation not permitted

WARNING: Pangenome analysis was skipped automatically due to low number of genomes to compare.

sed: can't read /media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/serotyping/serotyping.txt: No such file or directory
cp: cannot stat '/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/antibiotic_resistance_genes/*/tab': No such file or directory
cp: cannot stat '/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/virulence_genes/tab': No such file or directory
cp: cannot stat '/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/point_mutations//_PointFinder_results.txt': No such file or directory
ERROR: Can't open '/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/*resfinder_min90.tab' to summarize.
ERROR: Can't open '/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/*card_min90.tab' to summarize.
ERROR: Can't open '/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/*argannot_min90.tab' to summarize.
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/sedjvhr0Z’: Operation not permitted
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/sed42WdP3’: Operation not permitted
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/sedwfVdN1’: Operation not permitted
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/sedY9FRy5’: Operation not permitted
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/sedjqnLE4’: Operation not permitted
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/sedW4M2W4’: Operation not permitted
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/sedbU8CC8’: Operation not permitted
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/sed2iWrG7’: Operation not permitted
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/sedmpg1ia’: Operation not permitted
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/sed5Um638’: Operation not permitted
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/sed7RzBwd’: Operation not permitted
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/sedyXv1mb’: Operation not permitted
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/sedLw9Eaf’: Operation not permitted
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/sed8SaZee’: Operation not permitted
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/sedHtkWve’: Operation not permitted
cut: '/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/*resfinder_min90.tab': No such file or directory
cut: /media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/tmp2.txt: No such file or directory
paste: /media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/tmp2.txt: No such file or directory
sed: preserving permissions for ‘/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/report_files/sedx1IG4i’: Operation not permitted
cp: cannot stat '/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/fimH_typing/fimH_typing.txt': No such file or directory
cp: cannot stat '/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/serotyping/serotyping.txt': No such file or directory
cp: cannot stat '/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/plasmids/*tab': No such file or directory
chmod: changing permissions of '/media/bioinformatyka/Documents/roboczy_rafal/20200706_Tormes/EC5_out_test_fasq_8/render_report.sh': Operation not permitted
Warning message:
package ‘rmarkdown’ was built under R version 3.6.3

processing file: tormes_report.Rmd

|
| | 0%
|
|.. | 3%
ordinary text without R code

|
|.... | 5%
label: unnamed-chunk-1 (with options)
List of 3
$ echo : logi FALSE
$ message: logi FALSE
$ warning: logi FALSE

Registered S3 method overwritten by 'treeio':
method from
root.phylo ape
ggtree v2.0.4 For help: https://yulab-smu.github.io/treedata-book/

If you use ggtree in published research, please cite the most appropriate paper(s):

�[36m-�[39m Guangchuang Yu, Tommy Tsan-Yuk Lam, Huachen Zhu, Yi Guan. Two methods for mapping and visualizing associated data on phylogeny using ggtree. Molecular Biology and Evolution 2018, 35(12):3041-3043. doi: 10.1093/molbev/msy194
�[36m-�[39m Guangchuang Yu, David Smith, Huachen Zhu, Yi Guan, Tommy Tsan-Yuk Lam. ggtree: an R package for visualization and annotation of phylogenetic trees with their covariates and other associated data. Methods in Ecology and Evolution 2017, 8(1):28-36, doi:10.1111/2041-210X.12628

Attaching package: 'plotly'

The following object is masked from 'package:ggplot2':

last_plot

The following object is masked from 'package:stats':

filter

The following object is masked from 'package:graphics':

layout

treeio v1.10.0 For help: https://yulab-smu.github.io/treedata-book/

If you use treeio in published research, please cite:

LG Wang, TTY Lam, S Xu, Z Dai, L Zhou, T Feng, P Guo, CW Dunn, BR Jones, T Bradley, H Zhu, Y Guan, Y Jiang, G Yu. treeio: an R package for phylogenetic tree input and output with richly annotated and associated data. Molecular Biology and Evolution 2019, accepted. doi: 10.1093/molbev/msz240

|
|...... | 8%
ordinary text without R code

|
|........ | 11%
label: unnamed-chunk-2 (with options)
List of 1
$ echo: logi FALSE

|
|......... | 14%
ordinary text without R code

|
|........... | 16%
label: unnamed-chunk-3 (with options)
List of 1
$ echo: logi FALSE

Quitting from lines 75-78 (tormes_report.Rmd)
Error in read.table("sequencing_assembly_report.txt", header = T, sep = "\t", :
no lines available in input
Calls: ... withCallingHandlers -> withVisible -> eval -> eval -> read.table
In addition: Warning messages:
1: package 'ggplot2' was built under R version 3.6.3
2: package 'knitr' was built under R version 3.6.3
3: package 'plotly' was built under R version 3.6.3
4: package 'RColorBrewer' was built under R version 3.6.3
5: package 'reshape2' was built under R version 3.6.3

Execution halted

Dear all,
I got 4 fastq files from seq provider (L1 to L4) instead of 2 as I was used to get with another provider.
They told me is it because sequencing was done with Nextseq.
The question is how to accommodate 4 files in the metadata file for tormes?
Best,
Shlomo

I have successfully ran and obtain html results using tormes-1.2.0
Most of the results displayed perfectly in the browser, however some warning messages are shown:

Warning: arrange_() is deprecated as of dplyr 0.7.0.

Please use arrange() instead.

See vignette('programming') for more help

This warning is displayed once every 8 hours.

Call lifecycle::last_warnings() to see where this warning was generated.

Warning in structure(if (i %in% npscales()) uniq(d[[i]]) else d[[i]], class = oldClass(x[[i]])): Calling 'structure(NULL, *)' is deprecated, as NULL cannot have attributes.

Consider 'structure(list(), *)' instead.

Warning in structure(if (i %in% npscales()) uniq(d[[i]]) else d[[i]], class = oldClass(x[[i]])): Calling 'structure(NULL, *)' is deprecated, as NULL cannot have attributes.

Consider 'structure(list(), *)' instead.

Warning in structure(if (i %in% npscales()) uniq(d[[i]]) else d[[i]], class = oldClass(x[[i]])): Calling 'structure(NULL, *)' is deprecated, as NULL cannot have attributes.

Consider 'structure(list(), *)' instead.

Warning in structure(if (i %in% npscales()) uniq(d[[i]]) else d[[i]], class = oldClass(x[[i]])): Calling 'structure(NULL, *)' is deprecated, as NULL cannot have attributes.

Consider 'structure(list(), *)' instead.

Can they be just ignored?
Anything I need to update?
Thanks.

Hi, I am using tormes to analyse my four paired-end illumina data from 4 E. coli strains, and the final tormes_report.html report was generated.

In the section "Antibiotic resistance genes (ResFinder) count", the following Error is shown in the html file:

Error in scan(file = file, what = what, sep = sep, quote = quote, dec = dec, : line 21 did not have 3 elements)

Resfinder could be executed without error and AMR genes could also be predicted and shown in the html file.

NODE_80 length_9008 cov_19.565139 | 5064 | 7478 | fedB | 0/0 | 100.0 | 100.0 | gi:15551735 | FedC protein

NODE_80 length_9008 cov_19.565139 | 4379 | 5071 | fedC | 0/0 | 100.0 | 100.0 | gi:15551736 | FedD protein

Hi and many thanks for this extremely functional pipeline.

I've been using Tormes for a while now but after uninstalling and reinstalling it, I keep getting an ".html report file could not be created error" which is caused by a strange error regarding the tormes_report.Rmd file shown below:

The code in the tormes_report.Rmd file corresponding to lines 1799-1812 is the following:

Line 11662 is the following:

Any suggestions on how to fix this would be very much appreciated.

Kind regads,

Georgios

Hello, Narciso,

The tool is great! thank you again)
One question to discuss.
When I'm using filtering by default (prinseq), I have near thousand of contigs and the warning from Spades:
Too many erroneous kmers, the estimates might be unreliable
I I use --filtering trimmomatic, I have 111 contigs and no warnings.
How could be so? What is the exact difference between these methods?
The isolate is the same, the version is old 1.2.1

And Happy New Year!

Best regards,
Valery

Originally posted by @diegommartinezr in #1 (comment)

Hello Narciso,

I'm trying to install Tormes in a AWS distribution but I'm having issues with this line:

conda env create -n tormes-1.0 --file tormes-1.0.yml

I get:

Collecting package metadata (repodata.json): done
Solving environment: - Killed

I this because I need to use other type of AWS machine?

Thank you!

If you are using tormes with --genera Escherichia option enabled and you get a "warning" because the FimHTyper is not working, it migh be due because of the lack of one Perl package.
For solving this issue:

conda activate tormes-1.2.0
conda install -c bioconda perl-try-tiny-retry=0.004

This bug will be fixed in the next tormes release.
Sorry for the inconveniences,
Narciso

Hi! I'm interested in using your pipeline but I am using an Ion Torrent S5. Do you have any plan to make the pipeline compatible with single-end fastq files?

Hi, I am trying to install the latest tormes 1.2.0 version
But encounter the following error:

Quitting from lines 7-16 (tormes_report.Rmd)
Error: package or namespace load failed for 'ggtree':
package 'lattice' was installed by an R version with different internals; it needs to be reinstalled for use with this R version

Did I do something on the installation?
I used conda to install tormes 1.2.0 and ggtree.

Thanks

Dear all,
There's an issue in TORMES report when using samples' names composed only by numbers, as kindly reported by @biobrad .
At this time, the issue can be avoided by adding a single caracter at the beginning of the sample's name in the metadata file (such as "M123" instead of "123").
Sorry for the inconveniences.
Narciso

Hello, first thank you for this great pipeline!

I managed to install tormes on HPC (it took quite some time - tormes would not be installed with python version above 3.6.10), but the setup process was killed while trying to download the kraken (minikraken_8GB_202003.tgz).
Then I just moved on to analysis and encountered the following error:

$tormes -m /scratch/e1376a01/test/tormes -o /scratch/e1376a01/test/tormes_output
grep: /scratch/e1376a01/.conda/envs/tormes-1.3.0/bin/../files/config_file.txt: No such file or directory

So I tried to setup tormes again but now it says,

ERROR: /scratch/e1376a01/.conda/envs/tormes-1.3.0/bin/../CGE-modules/ already exist! Please check

Could you guide me in resolving this issue?
Thank you!
Jane

There is a bug in tormes-setup while generating the PATH for the kraken2 database in the config_file.txt.
If you are not using your own kraken2 database, just the one installed by default in TORMES, please type the following commands to solve this issue:

conda activate tormes-1.2.0 #skip in case the environment is already loaded
sed -i "s/minikraken_8GB_202003$/minikraken_8GB_20200312/" $(which tormes | sed "s/bin\/tormes/files\/config_file.txt/")

This issue will be solved in the next TORMES release.
Sorry for the inconveniences.
Narciso

Hi there,

I was giving TORMES a shot but ran into some issues.

I invoked TORMES as follows, on one single sample:

# Run TORMES
tormes --metadata samples_metadata.txt \
	--output GENOME \
	--no_mlst \
	--no_pangenome \
	--threads 16

This is the tormes.logfile:

Annotation started at: 2019-07-04 13:40
Tormes report started at: 2019-07-04 13:40
WARNING: html report file could not be created
TORMES pipeline finished at: 2019-07-04 13:40

When I then inspect all results folders, I see that the majority of the analyses are not performed. I then further inspected the stdout and noticed that everything up until QUAST runs fine but that the program executed after QUAST starts acting weird.

Here's a short snapshot of this log file:

Thank you for using QUAST!
Loading database... complete.
314954 sequences (129.48 Mbp) processed in 3.744s (5047.0 Kseq/m, 2074.85 Mbp/m).
  77123 sequences classified (24.49%)
  237831 sequences unclassified (75.51%)
/home/tormes/anaconda3/envs/tormes-1.0/bin/tormes: line 853: /media/ssd/genome_data/wd/GENOME/tormes.log: No such file or directory
/home/tormes/anaconda3/envs/tormes-1.0/bin/tormes: line 854: /media/ssd/genome_data/wd/GENOME/tormes.log: No such file or directory
parallel: Error: Cannot open input file `/media/ssd/genome_data/wd/GENOME/list.tmp': No such file or directory.
sed: can't read /media/ssd/genome_data/wd/GENOME/antibiotic_resistance_genes/resfinder/GENOME_resfinder.tab: No such file or directory
parallel: Error: Cannot open input file `/media/ssd/genome_data/wd/GENOME/list.tmp': No such file or directory.
sed: can't read /media/ssd/genome_data/wd/GENOME/antibiotic_resistance_genes/card/GENOME_card.tab: No such file or directory
parallel: Error: Cannot open input file `/media/ssd/genome_data/wd/GENOME/list.tmp': No such file or directory.
sed: can't read /media/ssd/genome_data/wd/GENOME/antibiotic_resistance_genes/argannot/GENOME_argannot.tab: No such file or directory
parallel: Error: Cannot open input file `/media/ssd/genome_data/wd/GENOME/list.tmp': No such file or directory.
sed: can't read /media/ssd/genome_data/wd/GENOME/virulence_genes/GENOME_vfdb.tab: No such file or directory
sed: can't read /media/ssd/genome_data/wd/GENOME/draft_genomes/GENOME.fasta: No such file or directory

It is also weird that these errors are thrown before PROKKA annotation.

Any idea what is going on?

Many thanks!
Sander

Hi

I try to analyze a sample, but when running the basic option of tormes (-m and -o) it indicates the following error:
grep: /home/dell/miniconda3/envs/tormes-1.2.1/bin/../files/config_file.txt: No existe el archivo o el directorio

Thanks for using tormes version 1.2.1
Let's check that all software are properly installed and all the data included in the metadata file is correct

/home/dell/Documentos/Secuencias/Genomasvolcan/PB-report/metadata.R: línea 1: error sintáctico cerca del elemento inesperado (' /home/dell/Documentos/Secuencias/Genomasvolcan/PB-report/metadata.R: línea 1: metadata=read.table("/home/dell/Documentos/Secuencias/Genomasvolcan/PB-report/metadata.tmp", header = T, sep = "\t", dec = ".")'
cut: /home/dell/Documentos/Secuencias/Genomasvolcan/PB-report/reads.tmp: No existe el archivo o el directorio
Software: found

ERROR: Binaries for MAUVE not found! Please check if:
* Binaries are not installed
* Binaries are installed but the path in /home/dell/miniconda3/envs/tormes-1.2.1/bin/../files/config_file.txt is incorrect

Can you help me??
Thanks :)

Dear Narciso,
as I previously mentioned in past issue #11 , we encountered several errors after running TORMES pipeline. We didn´t obtain any output for Pangenome and FimH analyses. Furthermore, species identification with Kraken gave unclassified results. We were wondering about the possible cause, as the tormes log did not display any warning message. Please find attached the log file:
tormes.log

Thank you!!

Is it possible to merge two separate reports into a single one? We have around 70 samples in total and had to run the analyses in two batches, presumably because of computing requierements.

Thanks!

ERROR: Software /home/miniconda3/envs/tormes-new/bin/../CGE-modules/fimtyper/fimtyper.pl required when -g/--genera 'Escherichia' is enabled not found! Please check if:
* Software is not installed
* Software is installed but the path in /home/miniconda3/envs/tormes-new/bin/../files/config_file.txt is incorrect

I love tormes. It is by far the best pipeline I have come across and I want other people to enjoy the brilliant work that Narciso has done as well.
I understand that Narciso is busy working on other projects so I hope he doesn't mind me putting these into once place to hopefully help others who want to try tormes but have a few issues with it.

After you have run all the tormes instructions provided by Narciso, you will have to do the following to get a few niggles sorted out

To get quast working properly, you will need to install the following extra quast components:
gridss, silva and busco.

The commands I used were:

quast-download-gridss
quast-download-silva
quast-download-busco

First Mauve fix:
navigate to your tormes folder and find the file named config_file.txt (should be in /tormes-1.0/files/)
The entry for MAUVE needs to be edited.
The entry that ends with 'mauve-2.4.0.r4736-0/Mauve.jar' will need to be changed.
Change the 0 after the 'r4736-' to a 1.
It should read mauve-2.4.0.r4736-1/Mauve.jar

Second Mauve fix:
progressivemauve has a dependency that had a recent update and it unfortunately broke progressivemauve.
This will culminate in a bunch of mauve errors and stack of Java Errors in your run.
To fix this, change your version of 'libgenome'
I use conda so i did the following:
conda install libgenome=1.3.1=h470a237_0

If you are having problems with the metadata file, I created a script that will populate the 'samples_metadata' file for you. Simply put the script in a folder that contains the R1 and R2.fastq.gz files that you want to run through tormes and run the script. The resulting samples_metadata file will be formatted correctly.
The script is attached.

Lastly, if you want to troubleshoot any other issues you are having Narciso advised to run tormes and have the error information go to a file. Add the following the end of the last command you put in as and argument with NO space: &>>error-tormes.txt 2>>error-tormes.txt &
IE: tormes --metadata samples_metadata.txt --output GENOME --no_mlst --no_pangenome --threads 16&>>error-tormes.txt 2>>error-tormes.txt &

tormes_meta_create.txt

TORMES is very similar to Nullarbor https://github.com/tseemann/nullarbor and has existed since Jan 2015 but has not been published.

There is no mention of Nullarbor in your paper or documentation.

Can you explain why?

Hello,

I am trying to use your pipeline on a salmonella sample without success. It says all the dependencies are installed and after the adapter trimming step nothing seems generate results, even tough it does not give any errors. How can I solve this?

Hi Narciso,

Unfortunately the solution for ggtree didn't work for me, but I found another way around it. It has a few more steps but it works nicely.

1. Create a new environment in conda using the attached txt file. You will have to change it to a .yml file though. (change the txt to yml). Call the new environment tormes_report.
   conda env create -n tormes_report --file tormes_report.yml
2. After it has been created, activate your new environment and run the following command (NOTE: change the path to your newly created conda 'tormes_report' install path)
   Rscript -e 'library(BiocManager); BiocManager::install("ggtree", ask = FALSE, lib.loc=YOUR/CONDA/INSTALLS/PATH/miniconda3/envs/tormes_report/lib/R/library/")'
3. Go the tormes folder where you ran the pipeline and which has your results.
4. Untar/unzip the reports file:
   tar -xzf report_files.tgz
5. run the following command:
   Rscript -e 'library(rmarkdown); rmarkdown::render("tormes_report.Rmd", "html_document", encoding="UTF-8")'
6. Your Tormes report should build and you will now have a file in your folder called 'tormes-report.html.
7. PROFIT.
   tormes_report.txt

Ran tormes on ubuntu via windows, all the assembly and individual statistics seem to be there, but I can't seem to find the final report. Where should it be in the tormes directory?