solgenomics / sgn Goto Github PK

The code behind the Sol Genomics Network, Cassavabase and other Breedbase websites

License: MIT License

R 0.73% Perl 36.30% Shell 0.01% CSS 0.78% JavaScript 11.76% HTML 0.09% Makefile 0.01% C 0.06% Prolog 0.01% Python 0.01% PLpgSQL 50.09% Raku 0.01% SCSS 0.01% Terra 0.17%

perl

sgn's Introduction

Breedbase / SGN

This repo contains code behind the Breedbase system (including Cassavabase, Musabase, Sweetpotatobase, Yambase) and the Sol Genomics Network website.

Docker images are available for the system at the Breedbase DockerHub page, so you shouldn't need to build the system yourself. Build scripts are available in the breedbase_dockerfile GitHub repo.

To run Breedbase, the easiest way is to git clone the repo https://github.com/solgenomics/breedbase_site/. Required prerequisites on the system are git, nginx, docker and docker compose. Follow the instructions on the breedbase_site wiki.

Contact SGN using the contact form on the page https://solgenomics.net/contact/form for more information.

Users should refer to the user's manual.

Developers should refer to the developer's guide.

:-)

sgn's People

Contributors

Stargazers

Watchers

sgn's Issues

Display features from only the current tomato genome build

Use locgroup=0 to filter out featurelocs

Implement feature loading script

Implement feature loading script for chado feature tables that also allows to update information.

test issue

This is a test issue.

Looks like you can put markdown in the body.

Add cross upload functionality

Allow people to upload cross information using an Excel file

show throbber on trial upload

Image of the week doesnt link to full image

The image of the week is only a thumbnail currently. It should link to the full image.

Fix broken ITAG2.3 bulk download link

http://solgenomics.net/itag/release/2.3/list_files comes up empty.

Load Simon's new cassava map into cassavabase

Bulk feature downloader doesn't know how to handle large_residues

For example, GSVIV12X_chr7 returns an empty FASTA file.

Implement trial deletion

Load Jose Blanca diversity genotype data

pedigree upload function

different from progeny upload. connects existing stocks with parent/offspring relationships

Some tests fail if qsub is not configured

CXGN::Tools::Run retrying cluster job submission.
CXGN::Tools::Run error running `qsub`: qsub: No default queue specified MSG=cannot locate queue
[error] Caught exception in SGN::Controller::Qtl->population "CXGN::Tools::Run: failed to submit cluster job, after 4 tries

=== R output ===

=== end R output ===
 at /home/leto/git/cxgn/sgn/t/../lib/SGN/Controller/Qtl.pm line 263
    SGN::Controller::Qtl::__ANON__('CXGN::Tools::Run: failed to submit cluster job, after 4 tries\x{a}') called at /home/leto/local-lib/lib/perl5/Try/Tiny.pm line 100
    Try::Tiny::try('CODE(0x14ce00d0)', 'Try::Tiny::Catch=REF(0x14ce0310)') called at /home/leto/git/cxgn/sgn/t/../lib/SGN/Controller/Qtl.pm line 264
    SGN::Controller::Qtl::_analyze_correlation('SGN::Controller::Qtl=HASH(0xaf0ad70)', 'SGN=HASH(0x13b27c90)') called at /home/leto/git/cxgn/sgn/t/../lib/SGN/Controller/Qtl.pm line 301
    SGN::Controller::Qtl::_correlation_output('SGN::Controller::Qtl=HASH(0xaf0ad70)', 'SGN=HASH(0x13b27c90)') called at /home/leto/git/cxgn/sgn/t/../lib/SGN/Controller/Qtl.pm line 59
    SGN::Controller::Qtl::population('SGN::Controller::Qtl=HASH(0xaf0ad70)', 'SGN=HASH(0x13b27c90)', 12) called at /home/leto/local-lib/lib/perl5/Catalyst/Action.pm line 65
    Catalyst::Action::execute('Catalyst::Action=HASH(0x1358e470)', 'SGN::Controller::Qtl=HASH(0xaf0ad70)', 'SGN=HASH(0x13b27c90)', 12) called at /home/leto/local-lib/lib/perl5/Catalyst.pm line 1667
    eval {...} called at /home/leto/local-lib/lib/perl5/Catalyst.pm line 1667
    Catalyst::execute('SGN=HASH(0x13b27c90)', 'SGN::Controller::Qtl', 'Catalyst::Action=HASH(0x1358e470)') called at /home/leto/local-lib/lib/perl5/Catalyst/Action.pm line 60
    Catalyst::Action::dispatch('Catalyst::Action=HASH(0x1358e470)', 'SGN=HASH(0x13b27c90)') called at /home/leto/local-lib/lib/perl5/Catalyst/ActionChain.pm line 38
    Catalyst::ActionChain::dispatch('Catalyst::ActionChain=HASH(0x14cb94c0)', 'SGN=HASH(0x13b27c90)') called at /home/leto/local-lib/lib/perl5/Catalyst/Controller.pm line 125
    Catalyst::Controller::_ACTION('SGN::Controller::Qtl=HASH(0xaf0ad70)', 'SGN=HASH(0x13b27c90)', 12) called at /home/leto/local-lib/lib/perl5/Catalyst/Action.pm line 65
    Catalyst::Action::execute('Catalyst::Action=HASH(0x1358df00)', 'SGN::Controller::Qtl=HASH(0xaf0ad70)', 'SGN=HASH(0x13b27c90)', 12) called at /home/leto/local-lib/lib/perl5/Catalyst.pm line 1667
    eval {...} called at /home/leto/local-lib/lib/perl5/Catalyst.pm line 1667
    Catalyst::execute('SGN=HASH(0x13b27c90)', 'SGN::Controller::Qtl', 'Catalyst::Action=HASH(0x1358df00)') called at /home/leto/local-lib/lib/perl5/Catalyst/Action.pm line 60
    Catalyst::Action::dispatch('Catalyst::Action=HASH(0x1358df00)', 'SGN=HASH(0x13b27c90)') called at /home/leto/local-lib/lib/perl5/Catalyst/Dispatcher.pm line 257
    Catalyst::Dispatcher::_do_forward('Catalyst::Dispatcher=HASH(0x25181e8)', 'forward', 'SGN=HASH(0x13b27c90)', '_ACTION') called at /home/leto/local-lib/lib/perl5/Catalyst/Dispatcher.pm line 237
    Catalyst::Dispatcher::forward('Catalyst::Dispatcher=HASH(0x25181e8)', 'SGN=HASH(0x13b27c90)', '_ACTION') called at /home/leto/local-lib/lib/perl5/Catalyst.pm line 342
    Catalyst::forward('SGN=HASH(0x13b27c90)', '_ACTION') called at /home/leto/local-lib/lib/perl5/Catalyst/Controller.pm line 99
    Catalyst::Controller::_DISPATCH('SGN::Controller::Qtl=HASH(0xaf0ad70)', 'SGN=HASH(0x13b27c90)', 12) called at /home/leto/local-lib/lib/perl5/Catalyst/Action.pm line 65
    Catalyst::Action::execute('Catalyst::Action=HASH(0x1358a5d0)', 'SGN::Controller::Qtl=HASH(0xaf0ad70)', 'SGN=HASH(0x13b27c90)', 12) called at /home/leto/local-lib/lib/perl5/Catalyst.pm line 1667
    eval {...} called at /home/leto/local-lib/lib/perl5/Catalyst.pm line 1667
    Catalyst::execute('SGN=HASH(0x13b27c90)', 'SGN::Controller::Qtl', 'Catalyst::Action=HASH(0x1358a5d0)') called at /home/leto/local-lib/lib/perl5/Catalyst/Action.pm line 60
    Catalyst::Action::dispatch('Catalyst::Action=HASH(0x1358a5d0)', 'SGN=HASH(0x13b27c90)') called at /home/leto/local-lib/lib/perl5/Catalyst/Dispatcher.pm line 257
    Catalyst::Dispatcher::_do_forward('Catalyst::Dispatcher=HASH(0x25181e8)', 'forward', 'SGN=HASH(0x13b27c90)', '/qtl/_DISPATCH') called at /home/leto/local-lib/lib/perl5/Catalyst/Dispatcher.pm line 237
    Catalyst::Dispatcher::forward('Catalyst::Dispatcher=HASH(0x25181e8)', 'SGN=HASH(0x13b27c90)', '/qtl/_DISPATCH') called at /home/leto/local-lib/lib/perl5/Catalyst.pm line 342
    Catalyst::forward('SGN=HASH(0x13b27c90)', '/qtl/_DISPATCH') called at /home/leto/local-lib/lib/perl5/Catalyst/Dispatcher.pm line 105
    Catalyst::Dispatcher::dispatch('Catalyst::Dispatcher=HASH(0x25181e8)', 'SGN=HASH(0x13b27c90)') called at /home/leto/local-lib/lib/perl5/Catalyst.pm line 1613
    Catalyst::dispatch('SGN=HASH(0x13b27c90)') called at /home/leto/local-lib/lib/perl5/Catalyst/Plugin/Static/Simple.pm line 76
    Class::MOP::Class:::around('CODE(0x2b931e0)', 'SGN=HASH(0x13b27c90)') called at /home/leto/local-lib/lib/perl5/x86_64-linux-gnu-thread-multi/Class/MOP/Method/Wrapped.pm line 162
    Class::MOP::Method::Wrapped::__ANON__('SGN=HASH(0x13b27c90)') called at /home/leto/local-lib/lib/perl5/x86_64-linux-gnu-thread-multi/Class/MOP/Method/Wrapped.pm line 91
    SGN::dispatch('SGN=HASH(0x13b27c90)') called at /home/leto/local-lib/lib/perl5/Catalyst.pm line 1963
    Catalyst::__ANON__() called at /home/leto/local-lib/lib/perl5/Try/Tiny.pm line 76
    eval {...} called at /home/leto/local-lib/lib/perl5/Try/Tiny.pm line 67
    Try::Tiny::try('CODE(0x13b471c0)', 'Try::Tiny::Catch=REF(0x13b45f30)') called at /home/leto/local-lib/lib/perl5/Catalyst.pm line 1969
    Catalyst::handle_request('SGN', 'env', 'HASH(0x14cc6ee8)') called at /home/leto/local-lib/lib/perl5/Catalyst/Engine.pm line 856
    Catalyst::Engine::__ANON__('CODE(0x13b4ef08)') called at /home/leto/local-lib/lib/perl5/Starman/Server.pm line 223
    Starman::Server::process_request('Starman::Server=HASH(0x13838ac0)') called at /home/leto/local-lib/lib/perl5/Net/Server.pm line 141
    Net::Server::run_client_connection('Starman::Server=HASH(0x13838ac0)') called at /home/leto/local-lib/lib/perl5/Net/Server/PreFork.pm line 273
    eval {...} called at /home/leto/local-lib/lib/perl5/Net/Server/PreFork.pm line 273
    Net::Server::PreFork::run_child('Starman::Server=HASH(0x13838ac0)') called at /home/leto/local-lib/lib/perl5/Net/Server/PreFork.pm line 229
    Net::Server::PreFork::run_n_children('Starman::Server=HASH(0x13838ac0)', 5) called at /home/leto/local-lib/lib/perl5/Net/Server/PreFork.pm line 144
    Net::Server::PreFork::loop('Starman::Server=HASH(0x13838ac0)') called at /home/leto/local-lib/lib/perl5/Net/Server.pm line 116
    Net::Server::run('Starman::Server=HASH(0x13838ac0)', 'port', 'ARRAY(0x13838cb8)', 'host', 'ARRAY(0x13838c88)', 'proto', 'ARRAY(0x13838ce8)', 'serialize', 'flock', ...) called at /home/leto/local-lib/lib/perl5/Starman/Server.pm line 61
    Starman::Server::run('Starman::Server=HASH(0x13838ac0)', 'CODE(0x13838898)', 'HASH(0x13838b68)') called at /home/leto/local-lib/lib/perl5/Plack/Handler/Starman.pm line 18
    Plack::Handler::Starman::run('Plack::Handler::Starman=HASH(0x22a31f8)', 'CODE(0x13838898)', 'HASH(0x135d8048)') called at /home/leto/local-lib/lib/perl5/Catalyst/Engine.pm line 837
    Catalyst::Engine::run('Catalyst::Engine=HASH(0x471c078)', 'SGN', 'CODE(0x13838898)', 3003, undef, 'HASH(0x135d8048)', 'Plack::Handler::Starman=HASH(0x22a31f8)') called at /home/leto/local-lib/lib/perl5/Catalyst.pm line 2418
    Catalyst::run('SGN', 3003, undef, 'HASH(0x135d8048)', 'Plack::Handler::Starman=HASH(0x22a31f8)') called at /home/leto/local-lib/lib/perl5/Catalyst/ScriptRole.pm line 91
    Catalyst::ScriptRole::_run_application('SGN::Script::Server=HASH(0x22159d8)') called at /home/leto/local-lib/lib/perl5/Catalyst/Script/Server.pm line 239
    Catalyst::Script::Server::run('SGN::Script::Server=HASH(0x22159d8)') called at /home/leto/local-lib/lib/perl5/Catalyst/ScriptRunner.pm line 47
    Catalyst::ScriptRunner::run('Catalyst::ScriptRunner', 'SGN', 'Server') called at t/t_server.pl line 35"

Add genotype download to download using lists tool

SolGS does not work on Cassavabase live site

Finish organizing test suite files

Too messy right now!

Transform accession lists to lists of accession unique names before analyses

Accession lists are validated by unique name and synonym. Before certain analyses can be run, the accession lists need to be transformed to their unique names, using the CXGN::List::Transform class.

Cvterm page should linkify the definition URL

Here is an example:

http://sgn-build-64.sgn.cornell.edu/chado/cvterm.pl?action=view&cvterm_id=22649

solqtl crashing for http://solgenomics.net/phenome/qtl_analysis.pl?population_id=18&cvterm_id=47497

Error in solve.default(t(Z) %% Z, t(Z) %% X) :
system is computationally singular: reciprocal condition number = 1.56925e-21
Calls: fitqtl -> fitqtlengine -> solve -> solve.default -> .Call
Execution halted

Request : GET http://solgenomics.net/phenome/qtl_analysis.pl?population_id=18&cvterm_id=47497
User-Agent : Mozilla/5.0 (Windows NT 5.1; rv:2.0.1) Gecko/20100101 Firefox/4.0.1
Referrer : http://solgenomics.net/chado/cvterm.pl?cvterm_id=47497
Client Addr: 193.205.144.3 (universi.unitus.it), 127.0.0.1 (localhost)
Worker PID : 28300

Create spreadsheet for phenotype upload from trial using list of traits

Fix new blast in Explorer

Refactor search pages

Feature search should only show organisms that have features

Currently, it shows all organisms and is really slow.

QTL search pagination is broken

Reported by Lukas:

The QTL search does not work correctly. It paginates the results wrong. Could this be fixed ASAP?
I searched for the string "fruit". The first result page had 3 results on it, but there were more pages. Clicking on page 4 gives the error: No results found.

Use lists for maternal and paternal parents on add cross dialog

Add readme to t/

Yep

search_help redefined at lib/SGN/Controller/Qtl.pm line 564

Bulk gene download

Should be very similar to bulk feature download and reuse code from the feature controller.

Improve Feature Search

make it fast

Config bug when sgn_local.conf is a symlink

This could be a bug in SGN core or Catalyst, but when sgn_local.conf is present, but a symlink, it is not detected correctly, so only the values in sgn.conf are found.

In silico digest tool does not deal with overlapping recognition sites

Hello,
the Result is wrong. BsaBI has overlapping sites that are all digested in paralell. Your model only works if there is ONE sequence, however in any reaction there are millions of sequences.

I have a repetitetive sequence: CATGATCATGATCATGATCATGATCATGAT
Cutting sites by your tool: CATGATCA'TGATCATGATCA'TGATCATGAT
Correct: CATGATCA'TGATCA'TGATCA'TGATCA'TGAT

Your tool will give wrong results.

Greetings
This message sent from SGN contact form

From:
A. Kolter [email protected]

(email sent from host , client ip 127.0.0.1)

Subject:
Error

Body:
Hello,
the Result is wrong. BsaBI has overlapping sites that are all digested in paralell. Your model only works if there is ONE sequence, however in any reaction there are millions of sequences.

I have a repetitetive sequence: CATGATCATGATCATGATCATGATCATGAT
Cutting sites by your tool: CATGATCA'TGATCATGATCA'TGATCATGAT
Correct: CATGATCA'TGATCA'TGATCA'TGATCA'TGAT

Your tool will give wrong results.

Greetings

Implement feature bulk download

Add a new tab to current bulk download

progeny upload function

Create fieldbook layouts with data types from ontology

error in R with alpha lattice design

probably Agricolae update related

Load potato SolCAP data

Field layout upload

Upload historic field layout information for a trial based on an Excel sheet.

Tests for mrna_and_protein_sequence

This function in SGN::View::Feature is relied upon by lots of code. It needs tests to make sure it works correctly in all edge cases (of which it has many).

add more bulk download functionality to feature search

Add a 'FASTA' item under the 'Save as' menu, which when clicked brings up a model dialog that lets the user select what kind of sequence will be in the FASTA file, and has a 'Download' button. When the download button is clicked in the modal dialog, the user's browser receives a fasta file of sequences.

The selections for type of sequence must be appropriate to the set of features selected. For example, if it's all genes or all mRNAs, or a mix of the both, it should have mRNA, cds, and protein selections.

solgenomics / sgn Goto Github PK

sgn's Introduction

Breedbase / SGN

sgn's People

Contributors

Stargazers

Watchers

Forkers

sgn's Issues

Recommend Projects

Recommend Topics

Recommend Org