Code Monkey home page Code Monkey logo

rnapolis-py's Introduction

RNApolis

A Python library and utilities containing RNA-related bioinformatics functions and classes.

Utilities

annotator

Annotator is a cutting-edge command-line tool engineered for the extraction and classification of secondary structures from biomolecular coordinates. This tool stands out in its ability to identify and categorize various base interactions, including base pairs, stacking, base-ribose, and base-phosphate interactions.

Comprehensive Classification:

  • Base Pair Analysis: Utilizes the Leontis-Westhof and Saenger methodologies for precise base pair classification.
  • Stacking and Interactions: Efficiently finds and classifies stacking, base-ribose, and base-phosphate interactions.

Flexible Output Formats:

  • Dot-Bracket Notation: Produces results in dot-bracket format, optimized for pseudoknot-order assignment. With the --extended option, it also encodes non-canonical base pairs in a unique way.
  • BPSEQ Format: Option to output results in BPSEQ format, detailing base interactions and classifications.
  • CSV Output: Generates a CSV file containing detailed classifications of all base interactions.
  • JSON Export: When enabled with --json, it outputs a JSON file detailing all identified base interactions and structural elements, including single strands, stems, and loops.
  • GraphViz Integration: The --dot option enables the creation of a GraphViz dot file, illustrating the relationships between various structural elements.

Enhanced Features:

  • Gap Detection: Capable of detecting and handling gaps in the PDB chain, breaking it into multiple strands for gaps larger than 2.4 Å.

Usage:

Execute annotator.py with your file path to initiate analysis. Customize your analysis and outputs using these options:

  • --bpseq [PATH]: Specify path for BPSEQ file output.
  • --csv [PATH]: Set path for CSV file output.
  • --json [PATH]: Define path for JSON file output.
  • --extended: Enable detailed secondary structure analysis.
  • --find-gaps: Activate gap detection and handling.
  • --dot [PATH]: Choose path for GraphViz DOT file output.

For help and more information, use -h or --help.

Examples

$ annotator --csv 8af0.csv --json 8af0.json --extended 8af0.cif.gz
    >strand_C
seq GCCCGCTUGUTACGCAGGC
cWW ((((((.((.((.((((((
cWH .........(.........
    >strand_D
seq GCCCGCTUGUTACGCAGGC
cWW )))))).)).)).))))))
cWH .........).........
Click here to see the output CSV
nt1 nt2 type classification-1 classification-2
C.G26 D.C44 base pair cWW XIX
C.C27 D.G43 base pair cWW XIX
C.C28 D.G42 base pair cWW XIX
C.C29 D.G41 base pair cWW
C.G30 D.C40 base pair cWW XIX
C.C31 D.G39 base pair cWW XIX
C.U33 D.A37 base pair cWW XX
C.G34 D.C36 base pair cWW XXVIII
C.U35 D.U35 base pair cWH
C.C36 D.G34 base pair cWW XXVIII
C.A37 D.U33 base pair cWW XX
C.G39 D.C31 base pair cWW XIX
C.C40 D.G30 base pair cWW XIX
C.G41 D.C29 base pair cWW
C.G42 D.C28 base pair cWW XIX
C.G43 D.C27 base pair cWW XIX
C.C44 D.G26 base pair cWW XIX
C.G26 C.C27 stacking upward
C.C27 C.C28 stacking upward
C.C28 C.C29 stacking upward
C.C28 D.G43 stacking inward
C.C29 C.G30 stacking upward
C.G30 C.C31 stacking upward
C.G30 D.G41 stacking inward
C.C31 C.C32 stacking upward
C.C32 C.U33 stacking upward
C.U33 C.G34 stacking upward
C.G34 C.U35 stacking upward
C.G34 D.A37 stacking inward
C.U35 C.C36 stacking upward
C.A37 C.C38 stacking upward
C.A37 D.G34 stacking inward
C.C38 C.G39 stacking upward
C.G39 C.C40 stacking upward
C.G41 C.G42 stacking upward
C.G41 D.G30 stacking inward
C.G42 C.G43 stacking upward
C.G42 D.C29 stacking inward
C.G43 C.C44 stacking upward
C.G43 D.C28 stacking inward
D.G26 D.C27 stacking upward
D.C27 D.C28 stacking upward
D.C28 D.C29 stacking upward
D.G30 D.C31 stacking upward
D.C31 D.C32 stacking upward
D.G34 D.U35 stacking inward
D.U35 D.C36 stacking inward
D.A37 D.C38 stacking upward
D.C38 D.G39 stacking upward
D.G39 D.C40 stacking upward
D.C40 D.G41 stacking upward
D.G41 D.G42 stacking upward
D.G42 D.G43 stacking upward
D.G43 D.C44 stacking upward
Click here to see the output JSON 
{
  "baseInteractions": {
    "basePairs": [
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 1,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 26,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 19,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 44,
            "icode": null,
            "name": "C"
          }
        },
        "lw": "cWW",
        "saenger": "XIX"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 2,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 27,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 18,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 43,
            "icode": null,
            "name": "G"
          }
        },
        "lw": "cWW",
        "saenger": "XIX"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 3,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 28,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 17,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 42,
            "icode": null,
            "name": "G"
          }
        },
        "lw": "cWW",
        "saenger": "XIX"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 4,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 29,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 16,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 41,
            "icode": null,
            "name": "G"
          }
        },
        "lw": "cWW",
        "saenger": null
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 5,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 30,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 15,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 40,
            "icode": null,
            "name": "C"
          }
        },
        "lw": "cWW",
        "saenger": "XIX"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 6,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 31,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 14,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 39,
            "icode": null,
            "name": "G"
          }
        },
        "lw": "cWW",
        "saenger": "XIX"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 8,
            "name": "U"
          },
          "auth": {
            "chain": "C",
            "number": 33,
            "icode": null,
            "name": "U"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 12,
            "name": "A"
          },
          "auth": {
            "chain": "D",
            "number": 37,
            "icode": null,
            "name": "A"
          }
        },
        "lw": "cWW",
        "saenger": "XX"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 9,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 34,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 11,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 36,
            "icode": null,
            "name": "C"
          }
        },
        "lw": "cWW",
        "saenger": "XXVIII"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 10,
            "name": "U"
          },
          "auth": {
            "chain": "C",
            "number": 35,
            "icode": null,
            "name": "U"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 10,
            "name": "U"
          },
          "auth": {
            "chain": "D",
            "number": 35,
            "icode": null,
            "name": "U"
          }
        },
        "lw": "cWH",
        "saenger": null
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 11,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 36,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 9,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 34,
            "icode": null,
            "name": "G"
          }
        },
        "lw": "cWW",
        "saenger": "XXVIII"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 12,
            "name": "A"
          },
          "auth": {
            "chain": "C",
            "number": 37,
            "icode": null,
            "name": "A"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 8,
            "name": "U"
          },
          "auth": {
            "chain": "D",
            "number": 33,
            "icode": null,
            "name": "U"
          }
        },
        "lw": "cWW",
        "saenger": "XX"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 14,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 39,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 6,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 31,
            "icode": null,
            "name": "C"
          }
        },
        "lw": "cWW",
        "saenger": "XIX"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 15,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 40,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 5,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 30,
            "icode": null,
            "name": "G"
          }
        },
        "lw": "cWW",
        "saenger": "XIX"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 16,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 41,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 4,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 29,
            "icode": null,
            "name": "C"
          }
        },
        "lw": "cWW",
        "saenger": null
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 17,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 42,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 3,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 28,
            "icode": null,
            "name": "C"
          }
        },
        "lw": "cWW",
        "saenger": "XIX"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 18,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 43,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 2,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 27,
            "icode": null,
            "name": "C"
          }
        },
        "lw": "cWW",
        "saenger": "XIX"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 19,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 44,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 1,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 26,
            "icode": null,
            "name": "G"
          }
        },
        "lw": "cWW",
        "saenger": "XIX"
      }
    ],
    "stackings": [
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 1,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 26,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "A",
            "number": 2,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 27,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 2,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 27,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "A",
            "number": 3,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 28,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 3,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 28,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "A",
            "number": 4,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 29,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 3,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 28,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 18,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 43,
            "icode": null,
            "name": "G"
          }
        },
        "topology": "inward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 4,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 29,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "A",
            "number": 5,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 30,
            "icode": null,
            "name": "G"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 5,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 30,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "A",
            "number": 6,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 31,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 5,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 30,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 16,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 41,
            "icode": null,
            "name": "G"
          }
        },
        "topology": "inward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 6,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 31,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "A",
            "number": 7,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 32,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 7,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 32,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "A",
            "number": 8,
            "name": "U"
          },
          "auth": {
            "chain": "C",
            "number": 33,
            "icode": null,
            "name": "U"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 8,
            "name": "U"
          },
          "auth": {
            "chain": "C",
            "number": 33,
            "icode": null,
            "name": "U"
          }
        },
        "nt2": {
          "label": {
            "chain": "A",
            "number": 9,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 34,
            "icode": null,
            "name": "G"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 9,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 34,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "A",
            "number": 10,
            "name": "U"
          },
          "auth": {
            "chain": "C",
            "number": 35,
            "icode": null,
            "name": "U"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 9,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 34,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 12,
            "name": "A"
          },
          "auth": {
            "chain": "D",
            "number": 37,
            "icode": null,
            "name": "A"
          }
        },
        "topology": "inward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 10,
            "name": "U"
          },
          "auth": {
            "chain": "C",
            "number": 35,
            "icode": null,
            "name": "U"
          }
        },
        "nt2": {
          "label": {
            "chain": "A",
            "number": 11,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 36,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 12,
            "name": "A"
          },
          "auth": {
            "chain": "C",
            "number": 37,
            "icode": null,
            "name": "A"
          }
        },
        "nt2": {
          "label": {
            "chain": "A",
            "number": 13,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 38,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 12,
            "name": "A"
          },
          "auth": {
            "chain": "C",
            "number": 37,
            "icode": null,
            "name": "A"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 9,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 34,
            "icode": null,
            "name": "G"
          }
        },
        "topology": "inward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 13,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 38,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "A",
            "number": 14,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 39,
            "icode": null,
            "name": "G"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 14,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 39,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "A",
            "number": 15,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 40,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 16,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 41,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "A",
            "number": 17,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 42,
            "icode": null,
            "name": "G"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 16,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 41,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 5,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 30,
            "icode": null,
            "name": "G"
          }
        },
        "topology": "inward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 17,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 42,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "A",
            "number": 18,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 43,
            "icode": null,
            "name": "G"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 17,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 42,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 4,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 29,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "inward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 18,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 43,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "A",
            "number": 19,
            "name": "C"
          },
          "auth": {
            "chain": "C",
            "number": 44,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "A",
            "number": 18,
            "name": "G"
          },
          "auth": {
            "chain": "C",
            "number": 43,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 3,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 28,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "inward"
      },
      {
        "nt1": {
          "label": {
            "chain": "B",
            "number": 1,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 26,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 2,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 27,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "B",
            "number": 2,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 27,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 3,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 28,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "B",
            "number": 3,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 28,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 4,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 29,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "B",
            "number": 5,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 30,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 6,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 31,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "B",
            "number": 6,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 31,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 7,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 32,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "B",
            "number": 9,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 34,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 10,
            "name": "U"
          },
          "auth": {
            "chain": "D",
            "number": 35,
            "icode": null,
            "name": "U"
          }
        },
        "topology": "inward"
      },
      {
        "nt1": {
          "label": {
            "chain": "B",
            "number": 10,
            "name": "U"
          },
          "auth": {
            "chain": "D",
            "number": 35,
            "icode": null,
            "name": "U"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 11,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 36,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "inward"
      },
      {
        "nt1": {
          "label": {
            "chain": "B",
            "number": 12,
            "name": "A"
          },
          "auth": {
            "chain": "D",
            "number": 37,
            "icode": null,
            "name": "A"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 13,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 38,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "B",
            "number": 13,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 38,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 14,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 39,
            "icode": null,
            "name": "G"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "B",
            "number": 14,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 39,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 15,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 40,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "B",
            "number": 15,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 40,
            "icode": null,
            "name": "C"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 16,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 41,
            "icode": null,
            "name": "G"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "B",
            "number": 16,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 41,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 17,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 42,
            "icode": null,
            "name": "G"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "B",
            "number": 17,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 42,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 18,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 43,
            "icode": null,
            "name": "G"
          }
        },
        "topology": "upward"
      },
      {
        "nt1": {
          "label": {
            "chain": "B",
            "number": 18,
            "name": "G"
          },
          "auth": {
            "chain": "D",
            "number": 43,
            "icode": null,
            "name": "G"
          }
        },
        "nt2": {
          "label": {
            "chain": "B",
            "number": 19,
            "name": "C"
          },
          "auth": {
            "chain": "D",
            "number": 44,
            "icode": null,
            "name": "C"
          }
        },
        "topology": "upward"
      }
    ],
    "baseRiboseInteractions": [],
    "basePhosphateInteractions": [],
    "otherInteractions": []
  },
  "bpseq": "1 G 38\n2 C 37\n3 C 36\n4 C 0\n5 G 34\n6 C 33\n7 T 0\n8 U 31\n9 G 30\n10 U 0\n11 T 28\n12 A 27\n13 C 0\n14 G 25\n15 C 24\n16 A 0\n17 G 22\n18 G 21\n19 C 20\n20 G 19\n21 C 18\n22 C 17\n23 C 0\n24 G 15\n25 C 14\n26 T 0\n27 U 12\n28 G 11\n29 U 0\n30 T 9\n31 A 8\n32 C 0\n33 G 6\n34 C 5\n35 A 0\n36 G 3\n37 G 2\n38 C 1",
  "dotBracket": ">strand_C\nGCCCGCTUGUTACGCAGGC\n(((.((.((.((.((.(((\n>strand_D\nGCCCGCTUGUTACGCAGGC\n))).)).)).)).)).)))",
  "extendedDotBracket": "    >strand_C\nseq GCCCGCTUGUTACGCAGGC\ncWW ((((((.((.((.((((((\ncWH .........(.........\n    >strand_D\nseq GCCCGCTUGUTACGCAGGC\ncWW )))))).)).)).))))))\ncWH .........).........",
  "stems": [
    {
      "strand5p": {
        "first": 1,
        "last": 3,
        "sequence": "GCC",
        "structure": "((("
      },
      "strand3p": {
        "first": 36,
        "last": 38,
        "sequence": "GGC",
        "structure": ")))"
      },
      "description": "Stem 1 3 GCC ((( 36 38 GGC )))"
    },
    {
      "strand5p": {
        "first": 5,
        "last": 6,
        "sequence": "GC",
        "structure": "(("
      },
      "strand3p": {
        "first": 33,
        "last": 34,
        "sequence": "GC",
        "structure": "))"
      },
      "description": "Stem 5 6 GC (( 33 34 GC ))"
    },
    {
      "strand5p": {
        "first": 8,
        "last": 9,
        "sequence": "UG",
        "structure": "(("
      },
      "strand3p": {
        "first": 30,
        "last": 31,
        "sequence": "TA",
        "structure": "))"
      },
      "description": "Stem 8 9 UG (( 30 31 TA ))"
    },
    {
      "strand5p": {
        "first": 11,
        "last": 12,
        "sequence": "TA",
        "structure": "(("
      },
      "strand3p": {
        "first": 27,
        "last": 28,
        "sequence": "UG",
        "structure": "))"
      },
      "description": "Stem 11 12 TA (( 27 28 UG ))"
    },
    {
      "strand5p": {
        "first": 14,
        "last": 15,
        "sequence": "GC",
        "structure": "(("
      },
      "strand3p": {
        "first": 24,
        "last": 25,
        "sequence": "GC",
        "structure": "))"
      },
      "description": "Stem 14 15 GC (( 24 25 GC ))"
    },
    {
      "strand5p": {
        "first": 17,
        "last": 19,
        "sequence": "GGC",
        "structure": "((("
      },
      "strand3p": {
        "first": 20,
        "last": 22,
        "sequence": "GCC",
        "structure": ")))"
      },
      "description": "Stem 17 19 GGC ((( 20 22 GCC )))"
    }
  ],
  "singleStrands": [
    {
      "strand": {
        "first": 5,
        "last": 6,
        "sequence": "GC",
        "structure": "(("
      },
      "is5p": false,
      "is3p": false,
      "description": "SingleStrand 5 6 GC (("
    },
    {
      "strand": {
        "first": 8,
        "last": 9,
        "sequence": "UG",
        "structure": "(("
      },
      "is5p": false,
      "is3p": false,
      "description": "SingleStrand 8 9 UG (("
    },
    {
      "strand": {
        "first": 11,
        "last": 12,
        "sequence": "TA",
        "structure": "(("
      },
      "is5p": false,
      "is3p": false,
      "description": "SingleStrand 11 12 TA (("
    },
    {
      "strand": {
        "first": 14,
        "last": 15,
        "sequence": "GC",
        "structure": "(("
      },
      "is5p": false,
      "is3p": false,
      "description": "SingleStrand 14 15 GC (("
    },
    {
      "strand": {
        "first": 24,
        "last": 25,
        "sequence": "GC",
        "structure": "))"
      },
      "is5p": false,
      "is3p": false,
      "description": "SingleStrand 24 25 GC ))"
    },
    {
      "strand": {
        "first": 27,
        "last": 28,
        "sequence": "UG",
        "structure": "))"
      },
      "is5p": false,
      "is3p": false,
      "description": "SingleStrand 27 28 UG ))"
    },
    {
      "strand": {
        "first": 30,
        "last": 31,
        "sequence": "TA",
        "structure": "))"
      },
      "is5p": false,
      "is3p": false,
      "description": "SingleStrand 30 31 TA ))"
    },
    {
      "strand": {
        "first": 33,
        "last": 34,
        "sequence": "GC",
        "structure": "))"
      },
      "is5p": false,
      "is3p": false,
      "description": "SingleStrand 33 34 GC ))"
    }
  ],
  "hairpins": [
    {
      "strand": {
        "first": 19,
        "last": 20,
        "sequence": "CG",
        "structure": "()"
      },
      "description": "Hairpin 19 20 CG ()"
    }
  ],
  "loops": [
    {
      "strands": [
        {
          "first": 3,
          "last": 5,
          "sequence": "CCG",
          "structure": "(.("
        },
        {
          "first": 34,
          "last": 36,
          "sequence": "CAG",
          "structure": ").)"
        }
      ],
      "description": "Loop 3 5 CCG (.( 34 36 CAG ).)"
    },
    {
      "strands": [
        {
          "first": 6,
          "last": 8,
          "sequence": "CTU",
          "structure": "(.("
        },
        {
          "first": 31,
          "last": 33,
          "sequence": "ACG",
          "structure": ").)"
        }
      ],
      "description": "Loop 6 8 CTU (.( 31 33 ACG ).)"
    },
    {
      "strands": [
        {
          "first": 9,
          "last": 11,
          "sequence": "GUT",
          "structure": "(.("
        },
        {
          "first": 28,
          "last": 30,
          "sequence": "GUT",
          "structure": ").)"
        }
      ],
      "description": "Loop 9 11 GUT (.( 28 30 GUT ).)"
    },
    {
      "strands": [
        {
          "first": 12,
          "last": 14,
          "sequence": "ACG",
          "structure": "(.("
        },
        {
          "first": 25,
          "last": 27,
          "sequence": "CTU",
          "structure": ").)"
        }
      ],
      "description": "Loop 12 14 ACG (.( 25 27 CTU ).)"
    },
    {
      "strands": [
        {
          "first": 15,
          "last": 17,
          "sequence": "CAG",
          "structure": "(.("
        },
        {
          "first": 22,
          "last": 24,
          "sequence": "CCG",
          "structure": ").)"
        }
      ],
      "description": "Loop 15 17 CAG (.( 22 24 CCG ).)"
    }
  ]
}

clashfinder

ClashFinder is a robust command-line utility designed for detecting atomic clashes in biomolecular structures provided in PDB or mmCIF formats. This tool is essential for researchers needing detailed insights into the spatial arrangement of atoms within molecular structures.

Key Features:

  • Versatile File Support: Compatible with both PDB and mmCIF file formats.
  • Occupancy-Based Filtering: Clashes are identified considering atoms' occupancies, with an option (--ignore-occupancy) to report clashes regardless of occupancy values.
  • Nucleic Acid Focused Analysis: While capable of detecting all clash types, it can be set to focus exclusively on nucleic acid chains (--nucleic-acid-only).
  • Autoclash Handling: By default, autoclashes (within the same residue) are reported, but this can be disabled (--ignore-autoclashes).
  • Atom Name Specific Clashes: The option --require-same-atom-name allows for reporting clashes only between atoms with identical names.
  • MolProbity Mode: Activating --enable-molprobity-mode adjusts the detection criteria to include 'weak' clashes, akin to the standards used in MolProbity.
  • CSV Output: Results can be stored in a CSV format for easy analysis and sharing (--csv [PATH]).

Usage:

Run clashfinder.py with your desired file path to start the clash detection process. Tailor the clash detection to your specific needs using the following flags:

  • --ignore-occupancy: Ignore occupancy checks in clash reporting.
  • --nucleic-acid-only: Limit detection to nucleic acid chains only.
  • --ignore-autoclashes: Exclude clashes within the same residue.
  • --require-same-atom-name: Report only clashes involving atoms with the same name.
  • --enable-molprobity-mode: Include 'weak' clashes in the detection.
  • --csv [PATH]: Specify path for CSV file output.

For additional information, use -h or --help.

metareader

metareader is a powerful command-line utility designed for extracting and transforming metadata from PDBx/mmCIF files into a JSON format. It stands out for its ability to handle any mmCIF category, including the atom_site, making it an indispensable tool for quick and efficient analysis of mmCIF files using JSON-capable software like jq or Python.

Key Features:

  • Flexible Data Extraction: Transforms mmCIF categories into an easily manageable JSON format.
  • Custom Category Selection: Allows users to specify one or multiple mmCIF categories for extraction (--category or -c).
  • Comprehensive Category Listing: Provides an option to list all available categories in a given mmCIF file (--list-categories or -l), aiding in targeted data analysis.

Usage:

Run metareader.py with the path to your mmCIF file. Customize your data extraction using these options:

  • --category CATEGORY, -c CATEGORY: Specify one or more mmCIF categories to extract (default is 'struct').
  • --list-categories, -l: List all categories available in the specified mmCIF file.

For further assistance, use -h or --help.

Examples

To check X-ray structure resolution:

$ metareader --category refine 8af0.cif.gz | jq -r .refine[0].ls_d_res_high
2.43

molecule-filter

molecule-filter is a specialized command-line tool designed to filter PDBx/mmCIF files based on specific molecular entity types. By default, it focuses on polyribonucleotide entities. Its unique feature is the embedded map of interdependencies between mmCIF categories, ensuring the output file contains comprehensive information related to the selected molecular chains, including data on missing atoms and modified residues.

Key Features:

  • Selective Entity Filtering: Filters information for specific entity types within PDBx/mmCIF files.
  • Default Focus on Polyribonucleotide: The tool defaults to polyribonucleotide entities but offers flexibility for other types.
  • Comprehensive Data Retention: Maintains interrelated data from different mmCIF categories, ensuring a thorough and detailed output file.

Usage:

Execute molecule_filter.py with the path to a PDBx/mmCIF file. Specify the molecule type to filter using the following option:

  • --type {cyclic-pseudo-peptide,other,peptide nucleic acid,polydeoxyribonucleotide,polydeoxyribonucleotide/polyribonucleotide hybrid,polypeptide(D),polypeptide(L),polyribonucleotide}: Choose a molecule type to filter (default: polyribonucleotide).

For additional help, use -h or --help.

motif-extractor

motif-extractor is an efficient command-line utility designed for analyzing molecular structures in BPSEQ or dot-bracket formats. It expertly generates a comprehensive list of structural elements, including single strands, stems, and loops, facilitating detailed insights into molecular configurations.

Key Features:

  • Support for Multiple Formats: Capable of processing inputs in both BPSEQ and dot-bracket formats.
  • Detailed Structural Analysis: Identifies and lists key structural elements within the molecular structure, such as single strands, stems, and loops.

Usage:

Run motif_extractor.py and specify the path to your input file in either BPSEQ or dot-bracket format. Use the following options to define your input file type:

  • --dbn DBN: Specify the path to a DotBracket format file.
  • --bpseq BPSEQ: Provide the path to a BPSEQ format file.

For more information, use -h or --help.

transformer

transformer is a highly functional command-line tool designed for processing and modifying PDBx/mmCIF files. Its primary functionality involves taking a specific category within an mmCIF file, such as atom_site, and copying data from one column to another. This feature is particularly useful for resolving issues with mmCIF "label" and "auth" naming schemes, allowing users to create a modified mmCIF file where both columns have identical values.

Key Features:

  • Targeted Column Copying: Facilitates the copying of data between columns within a specified mmCIF file category.
  • Naming Scheme Resolution: Aids in harmonizing "label" and "auth" naming schemes in mmCIF files, ensuring compatibility with various analytical tools.

Usage:

To use transformer.py, specify the path to your input mmCIF file and the desired output file path. Customize the data manipulation using these options:

  • --category CATEGORY: Define the category to work on (e.g., atom_site).
  • --copy-from COPY_FROM: Specify the column name to copy data from (e.g., label_asym_id).
  • --copy-to COPY_TO: Indicate the column name to copy data to (e.g., auth_asym_id).

For additional guidance, use -h or --help.

rfam-folder

rfam-folder is a command-line tool for generating consensus secondary structures for RNA sequences. This tool can process a single RNA sequence or multiple sequences from a FASTA file. It offers the flexibility to specify an Rfam family for targeted analysis, control the folding of the secondary structure, and set a limit on the number of structures generated.

Important! You need to have Infernal software installed for this script to run.

Usage:

The general usage pattern for rfam_folder.py is as follows:

usage: rfam_folder.py [-h] [--family FAMILY] [--no-fold] [--count COUNT] sequence

Positional Arguments:

  • sequence: An RNA sequence directly or a path to a FASTA file containing one or more sequences.

Options:

  • --family FAMILY: (Optional) Specify the name of the Rfam family to use. If not given, the entire Rfam database is searched for the sequence.
  • --no-fold: (Optional) Disable folding of the consensus secondary structure by RNAfold with constraints.
  • --count COUNT: (Optional) Set the maximum number of consensus secondary structures to generate per sequence, with a default of 1.

Examples

Generate a consensus structure for a single RNA sequence given specific Rfam family:

$ rfam-folder AUCGUUCACCUCAUAAAUUGAGUGAGACGGAAGUAGGUUAAAACCGAAGGAACGCAGU --family RF01739
>header
AUCGUUCACCUCAUAAAUUGAGUGAGACGGAAGUAGGUUAAAACCGAAGGAACGCAGU
..(((((..(((((.......)))))((....)).(((....)))....)))))....

rnapolis-py's People

Contributors

dependabot[bot] avatar tzok avatar

Stargazers

avatar avatar Rafael Vieira avatar Johon Li Tuobang 李拓邦 avatar Louis Meuret avatar Han Huang avatar Marcin Magnus avatar Aleksander avatar Kamil Niżnik avatar Bartosz Adamczyk avatar

Watchers

avatar avatar Han Huang avatar

Forkers

stefanomuscat modelturnedgeek wo0kie3

rnapolis-py's Issues

"math domain error" during annotator run

Hello, I was running the annotator for the 488D structure from the PDB, and stumbled across this error:

/path.../rnapolis/annotator.py:59: RuntimeWarning: invalid value encountered in scalar divide
  return math.acos(numpy.dot(v1, v2) / numpy.linalg.norm(v1) / numpy.linalg.norm(v2))
Traceback (most recent call last):
  File "/path.../rnapolis/annotator.py", line 645, in <module>
    main()
  File "/path.../rnapolis/annotator.py", line 619, in main
    structure2d, dot_brackets = extract_secondary_structure(
  File "/path.../rnapolis/annotator.py", line 491, in extract_secondary_structure
    base_interactions = extract_base_interactions(tertiary_structure, model)
  File "/path.../rnapolis/annotator.py", line 481, in extract_base_interactions
    stackings = find_stackings(tertiary_structure, model)
  File "/path.../rnapolis/annotator.py", line 440, in find_stackings
    angle_between_vectors(normal_i, normal_j),
  File "/path.../rnapolis/annotator.py", line 59, in angle_between_vectors
    return math.acos(numpy.dot(v1, v2) / numpy.linalg.norm(v1) / numpy.linalg.norm(v2))
ValueError: math domain error

The problem seems to be on the following lines from find_stackings:

    for i, j in kdtree.query_pairs(STACKING_MAX_DISTANCE):
        residue_i = coordinates_residue_map[coordinates[i]]
        residue_j = coordinates_residue_map[coordinates[j]]

        # check angle between normals
        normal_i = residue_i.base_normal_vector
        normal_j = residue_j.base_normal_vector

where for some reason, in one iteration both residue_i and residue_j take the value D.A151. Attached the input file.

488D.pdb.txt

Cached property and unexpected serialization

Hi,
I can see that @cahed_property comes with rnapolis 0.0.10 in commons.py. I didn't know this useful property. But there is a problem with that. Unlike @property, @cached_property behaves like normal instance attribute but with mechanism of caching. What wrong with that?

Assume that we have instance of Residue named residue. If we call residue.__dict__.keys() and cache is empty we get: dict_keys(['label', 'auth'])

But depending on what it is in cache we can also get for example:

  • dict_keys(['label', 'auth', 'chain', 'number'])
  • dict_keys(['label', 'auth', 'chain', ' molecule_type'])
  • dict_keys(['label', 'auth', 'chain', 'number', 'molecule_type'])
  • ...

So calling getter on @cached_property, e.g. residue.number make it regular attribute and our __dict__ is ""dynamic". When you use orjson you can get unexpected result:

"nt1": {
  "label": {
      "chain": "A",
      "number": 1,
      "name": "G"
  },
  "auth": {
      "chain": "A",
      "number": 1,
      "icode": null,
      "name": "G"
  },
  "chain": "A",
  "number": 1,
  "icode": null
}

Maybe you were aware of this behavior and you accept it. But if not - I cannot see any elegant solution (from adapters perspective :)):

  • Probably there is no way to exclude attribute in python in serialization (or I don't know that way)
  • I've tried with del and delattr but of course Residue is frozen...
  • Deep copy of Residue is time and memory wasting
  • Some magic with __dict__ or __slots__ ? But it's too hard for me with my python knowledge
  • Restore custom model in adapters
  • Remove some @cached_property to the needs of adapters

Docs: https://docs.python.org/3/library/functools.html#functools.cached_property

Python exception during annotator run

Hello,

I utilised RNApolis to obtain the Dot-Bracket annotations of RNA structures (in cif format) and I stumbled on the following errors:

  File "/home/branimir/anaconda3/bin/annotator", line 33, in <module>
    sys.exit(load_entry_point('RNApolis==0.3.15', 'console_scripts', 'annotator')())
             ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
  File "/home/branimir/anaconda3/lib/python3.11/site-packages/rnapolis/annotator.py", line 618, in main
    structure2d, dot_brackets = extract_secondary_structure(
                                ^^^^^^^^^^^^^^^^^^^^^^^^^^^^
  File "/home/branimir/anaconda3/lib/python3.11/site-packages/rnapolis/annotator.py", line 490, in extract_secondary_structure
    base_interactions = extract_base_interactions(tertiary_structure, model)
                        ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
  File "/home/branimir/anaconda3/lib/python3.11/site-packages/rnapolis/annotator.py", line 479, in extract_base_interactions
    base_pairs, base_phosphate, base_ribose = find_pairs(tertiary_structure, model)
                                              ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
  File "/home/branimir/anaconda3/lib/python3.11/site-packages/rnapolis/annotator.py", line 327, in find_pairs
    if residue_i < residue_j:
       ^^^^^^^^^^^^^^^^^^^^^
  File "/home/branimir/anaconda3/lib/python3.11/site-packages/rnapolis/tertiary.py", line 134, in __lt__
    return (self.model, self.chain, self.number, self.icode or " ") < (
           ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
TypeError: '<' not supported between instances of 'str' and 'NoneType'

Command line: annotator data/extracted_cif/8btk_B7.cif

The input file is attached in this issue.

Looking forward to your response.

8btk_B7.cif.txt

Support opening gzipped files

PDB and mmCIF files often come in gzipped files. The scripts in this repo could open .gz files directly (in-memory).

Enquiry about extract_secondary_structure

Hi @tzok, thanks for your great repo!
As the document is missing, could you please tell me what method you use to extract the secondary structure?
It would be nice if you could provide a code example for extracting secondary structures from PDB files!

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.