rdpstaff / framebot Goto Github PK

Hello. As I have a series of sequences to process, I try to use local FrameBot. Unfortunately, I cannot use protein as the reference, which can be sued on the web FrameBot. But the index works.
So I use the dataset in the RDP pipeline. It has the same problem. So how can I deal with it? Thank you.

Error Message:
java -jar /home/server/RDPTools/FrameBot.jar framebot -o amoaaob_test amoA_prot_ref.fasta /home/server/RDPTools/Xander_assembler/gene_resource/amoA_AOB/originaldata/nucl.fa Exception in thread "main" java.util.zip.ZipException: Not in GZIP format at java.util.zip.GZIPInputStream.readHeader(GZIPInputStream.java:164) at java.util.zip.GZIPInputStream.(GZIPInputStream.java:78) at java.util.zip.GZIPInputStream.(GZIPInputStream.java:90) at edu.msu.cme.rdp.framebot.index.FramebotIndex.readExternalIndex(FramebotIndex.java:186) at edu.msu.cme.rdp.framebot.cli.FramebotMain.main(FramebotMain.java:474) at edu.msu.cme.rdp.framebot.cli.Main.main(Main.java:50)

I am getting the following error being caused by certain sequences. When I remove the offending sequence the process continues fine, but I can't understand how the error is being caused as the input is exactly the same size and format as the other sequences. No sequences are put into the 'failed' output file.

My input is ~7000 rbcl gene nucleotide sequences being corrected against ~170 ncbi protein references as follows:

java -jar ~/programs/RDPTools/FrameBot.jar framebot  -N -o test bac_protein.fas rbcl_nucl.fas

Sequence input example (failure causing):

>DTM44_641
CGTTTTTTAAATTGTATGGAAGGTATTAACCGTGCTGCAGCTGCAACAGGTGAAGTTAAAGGTTCTTACTTAAACGTTACTGCAGCGACTATGGAAGAAGTACTTAAACGCTGTGAATATGCAAAAGAAGTCGGTTCTATTATTGTTATGATCGATTTAGTTATGGGTTATACAGCAATTCAAAGTGCTGCAATCTGGGCTCGTGACAACGATATGCTTTTACATTTACACCGTGCCGGTAACTCTACTTATGCACGTCAAAAAAGTCATGGTATTAATTTCCGTGTAATCTGTAAATGGATGCGTATGTCTGGTGTTGATCATATTCACGCTGGTACAGTTGTAGGTAAATTAGAAGGTGATCCTTTAATGATTAAAGGTTTCTATGATACTTTACGTTTAACAAAATTTAGAGGTTAATTTACCTTATGGTATTTTTCTTCGAAAGTGACATGGGCAAGTTTACGCCGTTGTATGCCTGTTGCATCTGGTGGTATTCATTGTGGTCAAATGCATCAATTAGTTCACTATTTAGGTGATGATGTAATAT

Error Message:

Exception in thread "main" java.lang.IllegalArgumentException: Cannot score R, ?
        at edu.msu.cme.rdp.alignment.pairwise.ScoringMatrix.score(ScoringMatrix.java:180)
        at edu.msu.cme.rdp.framebot.core.FramebotCore.computeMatrix(FramebotCore.java:81)
        at edu.msu.cme.rdp.framebot.core.FramebotCore.processSequence(FramebotCore.java:67)
        at edu.msu.cme.rdp.framebot.cli.FramebotMain.framebotItUp_prefilter(FramebotMain.java:136)
        at edu.msu.cme.rdp.framebot.cli.FramebotMain.main(FramebotMain.java:381)
        at edu.msu.cme.rdp.framebot.cli.Main.main(Main.java:48)

Hello,

I try to use FrameBot1.0 and i have a problem with index.
When i use framebot with index on example data all sequences are failed. When i do not use index many sequences are corrected.

Test with index

Commands :
java -jar /usr/local/bioinfo/src/FrameBot/current/dist/FrameBot.jar index /usr/local/bioinfo/src/FrameBot/current/example/nifH_test_refseq_prot.fa nifH_test.index
java -jar /usr/local/bioinfo/src/FrameBot/current/dist/FrameBot.jar framebot -o nifH_test nifH_test.index /usr/local/bioinfo/src/FrameBot/current/example/nifH_test_query.fa

Results :
-rw-r--r-- 1 owner GROUP 0 25 janv. 09:48 nifH_test_corr_nucl.fasta
-rw-r--r-- 1 owner GROUP 0 25 janv. 09:48 nifH_test_corr_prot.fasta
-rw-r--r-- 1 owner GROUP 56912 25 janv. 09:48 nifH_test_failed_framebot.txt
-rw-r--r-- 1 owner GROUP 17460 25 janv. 09:48 nifH_test_failed_nucl.fasta
-rw-r--r-- 1 owner GROUP 0 25 janv. 09:48 nifH_test_framebot.txt
-rw-r--r-- 1 owner GROUP 4149 25 janv. 09:46 nifH_test.index

Test without index

Command :
java -jar /usr/local/bioinfo/src/FrameBot/current/dist/FrameBot.jar framebot -N -o nifH_test_withoutIndex /usr/local/bioinfo/src/FrameBot/current/example/nifH_test_refseq_prot.fa /usr/local/bioinfo/src/FrameBot/current/example/nifH_test_query.fa

Results :
-rw-r--r-- 1 owner GROUP 16549 25 janv. 09:50 nifH_test_withoutIndex_corr_nucl.fasta
-rw-r--r-- 1 owner GROUP 6137 25 janv. 09:50 nifH_test_withoutIndex_corr_prot.fasta
-rw-r--r-- 1 owner GROUP 1156 25 janv. 09:50 nifH_test_withoutIndex_failed_framebot.txt
-rw-r--r-- 1 owner GROUP 359 25 janv. 09:50 nifH_test_withoutIndex_failed_nucl.fasta
-rw-r--r-- 1 owner GROUP 56090 25 janv. 09:50 nifH_test_withoutIndex_framebot.txt

Can you explain me this difference ?

I cloned the repository and tried to build the program using ant. However it gives such errors:

-do-compile:
[javac] Compiling 26 source files to /Users/menolinsharma/Framebot/build/classes
[javac] warning: [options] bootstrap class path not set in conjunction with -source 5
[javac] error: Source option 5 is no longer supported. Use 7 or later.
[javac] error: Target option 5 is no longer supported. Use 7 or later.

How do I install/build this program? I am not able to find a good source of instructions for building it given that I have only basic experience in command line. Thank you!