lh3 / misc Goto Github PK
View Code? Open in Web Editor NEWUseful small programs
Home Page: http://lh3lh3.users.sourceforge.net
Useful small programs
Home Page: http://lh3lh3.users.sourceforge.net
. |-- README # README |-- biodb # interface to biological databases | `-- batchUCSC.pl # batch UCSC data retrieval; http://lh3lh3.users.sourceforge.net/ucsc-mysql.shtml |-- klib.lua # the klib Lua library (from http://bit.ly/klibgit) |-- math # mathematics | |-- matmul_SSE # matrix multiplication in a few languages; plus SSE example | | |-- matmul-double.c # double numbers | | |-- matmul.c # float numbers; plus SSE implementation | | |-- matmul.js # javascript implementation | | |-- matmul.lua # lua implementation | | `-- matmul.pl # perl implementation | |-- lsoda.c # LSODA ODE solver | `-- unequal-jk.c # block Jackknife; requiring klib/ksort.h |-- popgen # population genetics | `-- genetic_dist.js # compute the genetic distance from deCODE genetic maps |-- seq # sequence analysis | |-- seqbility # unitilities to compute mappability http://bit.ly/snpable | | |-- apply_mask_l.c # apply a mask to a list of sites | | |-- apply_mask_s.c # apply a mask to a sequence | | |-- gen_mask.c # generate a mask from a raw mask | | |-- gen_raw_mask.pl # generate a raw mask from BWA SAM output | | |-- splitfa.c # split a reference sequence to overlapping short mers | | |-- uniq-dist-acc.pl # get the accumulative distribution from uniq-dist output | | |-- uniq-dist-cmp.pl # compare to uniq-dist output | | |-- uniq-dist.c # compute the distance between adjacent loci in unique regions | | `-- [...] | |-- seqtk # toolkit for manipulation FASTA/Q files | | `-- [...] | |-- bc2rg.lua # generate the RG SAM tag from the BC tag | |-- bioutils.lua # collection of bioinfo related (tiny) utilites | `-- sam2bp.lua # collect break points from a SAM file containing split hits `-- sys # system related programs `-- asub # array job submiter
Hello,
I have a chromosome (Chr1) that is 196345723 bp in length.
psmc/utils/./splitfa Sept22Assembly.fasta 35 | split -l 20000000
#This step produced three files and I confirmed the correct end to chromosome 1 in xaa
#kmer fasta headers are like so
Chr1_1
AGAGTGGTGGGGACAAGGCTCAGAGCCTGAACTGA
cat xaa xab xac > xxaa
#I also confirmed the correct end to chromosome 1 in xxaa
#I viewed mapped reads for Chr1 and find that there are sites mapping well up into 196000000
I also find that all representative sites for Chr1 stop at 5609912 which is eerily similar to the last kmer fasta header for Chr1 (>Chr1_5609878).
Any help here would be greatly appreciated,
Nicolas
Hi, I wonder if you can provide an example using your simplified interface of the LSODA solver. Could you also explain what each input variable means? Thank you so much.
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.