Comments (5)
I don't think bwa has any issues with leading @
in quality. For example, the following sequence is mapped just fine:
@1
CACTAAGCACACAGAGAATAATGTCTAGAATCTGAGTGCCATGTTATCAAATTGTACTGA
+
@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
Show me the exact command line and the sequence you have problem with.
The convention is to have /1
and /2
at the end. Please follow the convention.
from bwa.
Please DON'T use email. Write your message in markdown on this github issue page. The quality string of your first sequence is shorter than reads, but I don't know if it's email that screws up the format. Also use grep -n -A3 -B4
.
from bwa.
Thanks for your reply.
Here is my command:
bwa mem -t 12 -M AaegL4.masked.masked.top3.fasta trimmed_dilutions_3_barcoded_1.fastq trimmed_dilutions_3_barcoded_2.fastq >trimmed_dilutions_3_vs_Aaegypti_masked_masked_top3-BWA.sam
The error was:
[mem_sam_pe] paired reads have different names: "SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC", "@@ddddd,AAFDFCB22CBAB?HH<AFGHG6CGIIIGEHHIGG?B9/9?@)8/BB<FEGDA7=)..?=A;;BA,6;(-5;3-;@(,5;A<(5544(:43((4083(&(++9:A@4(4)+((+(:@(4(5&&)05((+(++4:((+(+)("
So I use grep to find that read both in two paired files:
$ grep -n -A 3 'SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC' trimmed_dilutions_3_barcoded_1.fastq115889:@SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC115890-ACGGACCATCAGACAACGAACCATCAGAGGACGGACCATCAGACAACGAACCATCAGAGGACAGACGATCAGACAACGAACCATCAGAGGACGGACCATCAGACAACGAACCATCAGAGGACGGACC115891-+115892-CGDGHFGGGGHIIIGCHA5CGEHHEEE<@=>=?;>62CC:3<?BB(200@(4(:08<(2>A&&28&4>:(<<588&084(((((+(2&&)&&24(43:(2<B3+2&&+49:+(:((+&&)))
$ grep -n -A 3 'SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC' trimmed_dilutions_3_barcoded_2.fastq
115889:@SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC115890-CCTCTGATTGTTCGTTTTCTGATGGTCCGTCCTCTGATGGTTCGTTGTCTGATGGTCCGTCCTCTGATGGTTCGTTGTCTGATGGTCCGTCTTCTGATGGTTCGTTGCCTGATGGTTCGTCCTCTGGTCGGTCGTCCTCTGATGGTTCGT115891-+115892-@@@ddddd,AAFDFCB22CBAB?HH<AFGHG6CGIIIGEHHIGG?B9/9?@)8/BB<FEGDA7=)..?=A;;BA,6;(-5;3-;@(,5;A<(5544(:43((4083(&(++9:A@4(4)+((+(:@(4(5&&)05((+(++4:((+(+)(
I have no idea why error occured. Please help. Thank you very much.
Best,
Yang
Date: Sat, 18 Jun 2016 15:44:56 -0700
From: [email protected]
To: [email protected]
CC: [email protected]; [email protected]
Subject: Re: [lh3/bwa] BWA won't work when the first letter of the quality line in FASTQ file is '@' symbol. (#74)
I don't think bwa has any issues with leading @ in quality. For example, the following sequence is mapped just fine:
@1
CACTAAGCACACAGAGAATAATGTCTAGAATCTGAGTGCCATGTTATCAAATTGTACTGA
+
@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
Show me the exact command line and the sequence you have problem with.
The convention is to have /1 and /2 at the end. Please follow the convention.
―
You are receiving this because you authored the thread.
Reply to this email directly, view it on GitHub, or mute the thread.
from bwa.
Sorry, I can't read your message as everything is concatenated together. Please use markdown to format.
from bwa.
I am sorry about that. Thanks for your reply.
Here is my command:
bwa mem -t 12 -M AaegL4.masked.masked.top3.fasta trimmed_dilutions_3_barcoded_1.fastq trimmed_dilutions_3_barcoded_2.fastq >trimmed_dilutions_3_vs_Aaegypti_masked_masked_top3-BWA.sam
The error was:
[mem_sam_pe] paired reads have different names: “SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC”, “@@ddddd,AAFDFCB22CBAB?HH<AFGHG6CGIIIGEHHIGG?B9/9?@)8/BB<FEGDA7=)..?=A;;BA,6;(-5;3-;@(,5;A<(5544(:43((4083(&(++9:A@4(4)+((+(:@(4(5&&)05((+(++4:((+(+)(“
So I use grep to find that read both in two paired files:
$ grep -n -A 3 ‘SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC’ trimmed_dilutions_3_barcoded_1.fastq
115889:@SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC
115890-ACGGACCATCAGACAACGAACCATCAGAGGACGGACCATCAGACAACGAACCATCAGAGGACAGACGATCAGACAACGAACCATCAGAGGACGGACCATCAGACAACGAACCATCAGAGGACGGACC
115891-+
115892-CGDGHFGGGGHIIIGCHA5CGEHHEEE<@=>=?;>62CC:3<?BB(200@(4(:08<(2>A&&28&4>:(<<588&084(((((+(2&&)&&24(43:(2<B3+2&&+49:+(:((+&&)))
$ grep -n -A 3 ‘SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC’ trimmed_dilutions_3_barcoded_2.fastq
115889:@SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC
115890-CCTCTGATTGTTCGTTTTCTGATGGTCCGTCCTCTGATGGTTCGTTGTCTGATGGTCCGTCCTCTGATGGTTCGTTGTCTGATGGTCCGTCTTCTGATGGTTCGTTGCCTGATGGTTCGTCCTCTGGTCGGTCGTCCTCTGATGGTTCGT
115891-+
115892-@@@ddddd,AAFDFCB22CBAB?HH<AFGHG6CGIIIGEHHIGG?B9/9?@)8/BB<FEGDA7=)..?=A;;BA,6;(-5;3-;@(,5;A<(5544(:43((4083(&(++9:A@4(4)+((+(:@(4(5&&)05((+(++4:((+(+)(
I have no idea why error occured. Please help. Thank you very much.
Best,
Yang
Date: Sat, 18 Jun 2016 16:04:55 -0700
From: [email protected]
To: [email protected]
CC: [email protected]; [email protected]
Subject: Re: [lh3/bwa] BWA won't work when the first letter of the quality line in FASTQ file is '@' symbol. (#74)
Sorry, I can't read your message as everything is concatenated together. Please use markdown to format.
—
You are receiving this because you authored the thread.
Reply to this email directly, view it on GitHub, or mute the thread.
from bwa.
Related Issues (20)
- bwa mem hangs after a few thousand reads
- Did bwa index use the SA-IS algorithm?
- Fail to read header from fasta input
- When i use bwa for mapping with grch37.p13.fa and hg19.fa,there exists some differences in some regions.
- Build fails with LTO
- [M::bwa_idx_load_from_disk] read 0 ALT contigs
- Indexing large genome failed HOT 3
- no ID within the read group line
- Could anyone tell me the exact meaning of '-5SP'?
- missing `bwa-0.7.18.tar.bz2` for 0.7.18 release HOT 1
- Is there MD tag in output of bwa?
- Set min insert size with -I option. Why do I still get proper pairs with insert size < min insert size?
- bwa alignment of Nanopro sequences to call the transposable elements (TEs)
- How are ambiguity charaters handled in BWA?
- the significance of the -V parameter and XR tag
- BWA and short read mapping
- Continuation after error "paired reads have different names" HOT 1
- How can i obtain all the regions reads hit. (in duplication region) HOT 2
- unexpected high quality scores with chimeric SA alternatives reported HOT 3
- feature proposal: allow tag name to be specified for storing fastq comment for read HOT 1
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from bwa.