BWA won't work when the first letter of the quality line in FASTQ file is '@' symbol. about bwa HOT 5 CLOSED

I don't think bwa has any issues with leading @ in quality. For example, the following sequence is mapped just fine:

@1
CACTAAGCACACAGAGAATAATGTCTAGAATCTGAGTGCCATGTTATCAAATTGTACTGA
+
@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@

Show me the exact command line and the sequence you have problem with.

The convention is to have /1 and /2 at the end. Please follow the convention.

from bwa.

Please DON'T use email. Write your message in markdown on this github issue page. The quality string of your first sequence is shorter than reads, but I don't know if it's email that screws up the format. Also use grep -n -A3 -B4.

from bwa.

Thanks for your reply.
Here is my command:
bwa mem -t 12 -M AaegL4.masked.masked.top3.fasta trimmed_dilutions_3_barcoded_1.fastq trimmed_dilutions_3_barcoded_2.fastq >trimmed_dilutions_3_vs_Aaegypti_masked_masked_top3-BWA.sam
The error was:
[mem_sam_pe] paired reads have different names: "SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC", "@@ddddd,AAFDFCB22CBAB?HH<AFGHG6CGIIIGEHHIGG?B9/9?@)8/BB<FEGDA7=)..?=A;;BA,6;(-5;3-;@(,5;A<(5544(:43((4083(&(++9:A@4(4)+((+(:@(4(5&&)05((+(++4:((+(+)("
So I use grep to find that read both in two paired files:
$ grep -n -A 3 'SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC' trimmed_dilutions_3_barcoded_1.fastq115889:@SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC115890-ACGGACCATCAGACAACGAACCATCAGAGGACGGACCATCAGACAACGAACCATCAGAGGACAGACGATCAGACAACGAACCATCAGAGGACGGACCATCAGACAACGAACCATCAGAGGACGGACC115891-+115892-CGDGHFGGGGHIIIGCHA5CGEHHEEE<@=>=?;>62CC:3<?BB(200@(4(:08<(2>A&&28&4>:(<<588&084(((((+(2&&)&&24(43:(2<B3+2&&+49:+(:((+&&)))
$ grep -n -A 3 'SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC' trimmed_dilutions_3_barcoded_2.fastq
115889:@SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC115890-CCTCTGATTGTTCGTTTTCTGATGGTCCGTCCTCTGATGGTTCGTTGTCTGATGGTCCGTCCTCTGATGGTTCGTTGTCTGATGGTCCGTCTTCTGATGGTTCGTTGCCTGATGGTTCGTCCTCTGGTCGGTCGTCCTCTGATGGTTCGT115891-+115892-@@@ddddd,AAFDFCB22CBAB?HH<AFGHG6CGIIIGEHHIGG?B9/9?@)8/BB<FEGDA7=)..?=A;;BA,6;(-5;3-;@(,5;A<(5544(:43((4083(&(++9:A@4(4)+((+(:@(4(5&&)05((+(++4:((+(+)(

I have no idea why error occured. Please help. Thank you very much.

Best,

Yang

Date: Sat, 18 Jun 2016 15:44:56 -0700
From: [email protected]
To: [email protected]
CC: [email protected]; [email protected]
Subject: Re: [lh3/bwa] BWA won't work when the first letter of the quality line in FASTQ file is '@' symbol. (#74)

I don't think bwa has any issues with leading @ in quality. For example, the following sequence is mapped just fine:

@1
CACTAAGCACACAGAGAATAATGTCTAGAATCTGAGTGCCATGTTATCAAATTGTACTGA
+
@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@

Show me the exact command line and the sequence you have problem with.

The convention is to have /1 and /2 at the end. Please follow the convention.

―
You are receiving this because you authored the thread.
Reply to this email directly, view it on GitHub, or mute the thread.

from bwa.

Sorry, I can't read your message as everything is concatenated together. Please use markdown to format.

from bwa.

I am sorry about that. Thanks for your reply.
Here is my command:

bwa mem -t 12 -M AaegL4.masked.masked.top3.fasta trimmed_dilutions_3_barcoded_1.fastq trimmed_dilutions_3_barcoded_2.fastq >trimmed_dilutions_3_vs_Aaegypti_masked_masked_top3-BWA.sam
The error was:
[mem_sam_pe] paired reads have different names: “SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC”, “@@ddddd,AAFDFCB22CBAB?HH<AFGHG6CGIIIGEHHIGG?B9/9?@)8/BB<FEGDA7=)..?=A;;BA,6;(-5;3-;@(,5;A<(5544(:43((4083(&(++9:A@4(4)+((+(:@(4(5&&)05((+(++4:((+(+)(“
So I use grep to find that read both in two paired files:
$ grep -n -A 3 ‘SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC’ trimmed_dilutions_3_barcoded_1.fastq
115889:@SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC
115890-ACGGACCATCAGACAACGAACCATCAGAGGACGGACCATCAGACAACGAACCATCAGAGGACAGACGATCAGACAACGAACCATCAGAGGACGGACCATCAGACAACGAACCATCAGAGGACGGACC
115891-+
115892-CGDGHFGGGGHIIIGCHA5CGEHHEEE<@=>=?;>62CC:3<?BB(200@(4(:08<(2>A&&28&4>:(<<588&084(((((+(2&&)&&24(43:(2<B3+2&&+49:+(:((+&&)))
$ grep -n -A 3 ‘SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC’ trimmed_dilutions_3_barcoded_2.fastq
115889:@SL-HDG:781:H32CHADXY:2:2214:6469:48527:BX:AACACGTAGCGAAC:BC:TCGCCAGC
115890-CCTCTGATTGTTCGTTTTCTGATGGTCCGTCCTCTGATGGTTCGTTGTCTGATGGTCCGTCCTCTGATGGTTCGTTGTCTGATGGTCCGTCTTCTGATGGTTCGTTGCCTGATGGTTCGTCCTCTGGTCGGTCGTCCTCTGATGGTTCGT
115891-+
115892-@@@ddddd,AAFDFCB22CBAB?HH<AFGHG6CGIIIGEHHIGG?B9/9?@)8/BB<FEGDA7=)..?=A;;BA,6;(-5;3-;@(,5;A<(5544(:43((4083(&(++9:A@4(4)+((+(:@(4(5&&)05((+(++4:((+(+)(
I have no idea why error occured. Please help. Thank you very much.
Best,
Yang
​

Date: Sat, 18 Jun 2016 16:04:55 -0700
From: [email protected]
To: [email protected]
CC: [email protected]; [email protected]
Subject: Re: [lh3/bwa] BWA won't work when the first letter of the quality line in FASTQ file is '@' symbol. (#74)

Sorry, I can't read your message as everything is concatenated together. Please use markdown to format.

—
You are receiving this because you authored the thread.
Reply to this email directly, view it on GitHub, or mute the thread.

from bwa.