Comments (2)
you got it, boss!
$ ./bcalm -in ../test/reads3_small.fa -all-abundance-counts
[..]
$ head reads3_small.unitigs.fa
>0 LN:i:80 ab:Z:2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2
GAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTG
>1 LN:i:32 ab:Z:2 2
GACACATGCAGCTCCCGGAGACGGTCACAGCT
from bcalm.
Thanks!
from bcalm.
Related Issues (20)
- new release soon? HOT 2
- Running bcalm raises error: `cannot create a union-find data structure, too many elements.` HOT 6
- error: 'predecessors' following the 'template' keyword does not refer to a template HOT 8
- Error: libc++abi.dylib: terminating with uncaught exception of type std::out_of_range: basic_string HOT 5
- Compiling bcalm causes trouble when no .git repository is found HOT 1
- Output of bcalm2 similar to minia 3.2.1 unitigs? HOT 2
- Memory error with many reference genomes as input HOT 16
- High frequency of nodes with degree of two with length = 2k-1 HOT 2
- .fa files contain lowercase `km` instead of the documented uppercase `KM` HOT 3
- bcalm 2.2.1 on conda for Mac OS X produces incorrect cDBG (the zombie bug returns!!) HOT 12
- Add better input parsing HOT 1
- Improve error message for bad fasta input HOT 1
- Apparently bcalm crashes with very large k's (4096) HOT 1
- bcalm -version return code 1 to shell
- Glue is too strong, because glue files are not deleted.
- insert unitig disregarding the reverse complement HOT 1
- Option `-out-dir` is not used ? HOT 1
- bug report on a metagenomics dataset HOT 3
- Add header description with `-all-abundance-counts` HOT 2
- Is the output file reproducible? HOT 2
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from bcalm.