Code Monkey home page Code Monkey logo

kraken-linked's People

Contributors

dcdanko avatar derrickwood avatar druvus avatar eclarke avatar fbreitwieser avatar yesimon avatar

Stargazers

avatar avatar avatar avatar avatar avatar

Watchers

avatar avatar

Forkers

pythseq

kraken-linked's Issues

If threads more than 1, there are errors "malformed fastq file"

Hi, Danko.
When I used your test data "tests/data/sample_fastq_zymo_control.fq", and ran code with 4 threads, There are errors as below, but ran code with 1 thread, everything went well. I am wondering why this happens?

krakenuniq --threads 4 --db refseq --fastq-input sample_fastq_zymo_control.fq --output sample.kraken.out --classified-out sample.class.out --report-file sample.report

Warning: Overwriting sample.report.
kraken-linked/bin/classify -d refseq/database.kdb -i refseq/database.idx -t 4 -f -C sample.class.out -o sample.kraken.out -r sample.report -a refseq/taxDB -p 12 sample_fastq_zymo_control.fq
Database refseq/database.kdb
Loaded database with 15102006752 keys with k of 31 [val_len 4, key_len 8].
Reading taxonomy index from refseq/taxDB. Done, read 1845140 taxa.
Writing Kraken output to sample.kraken.out
classify: malformed fastq file - quality header (@D00547:847:HYHNTBCXX:2:2208:1571:34089 BX:Z:CTGCGAGGTCTCCCTA-1)
classify: malformed fastq file - sequence header (TAAAAGAGAACCGGGGCCGAAACCCCGGTTGTTATGATTAGCTTGCGACGGC)
classify: malformed fastq file - sequence header (TAAAAGAGAACCGGGGCCGAAACCCCGGTTGTTATGATTAGCTTGCGACGGC

Final output lists no reads classified out of none

Final output to stderr looks like this

0 sequences (0.00 Mbp) processed in 1.308s (0.0 Kseq/m, 0.00 Mbp/m).
  0 sequences classified (-nan%)
  0 sequences unclassified (-nan%)

Writes (apparently) well formed reports and read classifications though.

Report lists same species multiple times

Fairly sure this isn't the original behavior

$ cat <report> | grep -F 'species' | grep -vF group | grep -vF 'sub'
11.82   385     354     20734   1.03    0.001111        550     species                   Enterobacter cloacae
2.333   76      76      8193    1.01    0.0002069       562     species                 Escherichia coli
4.36    142     0       6388    1.02    0.001259        219572  species                 Pseudomonas antarctica
0.6141  20      20      1023    1.01    1.786e-05       294     species                   Pseudomonas fluorescens
22.87   745     739     68771   1.05    0.01463 1282    species                   Staphylococcus epidermidis
5.496   179     0       28447   1.03    0.01222 1270    species                   Micrococcus luteus
10.04   654     644     42424   1.07    0.002274        550     species                   Enterobacter cloacae
1.167   76      76      16831   1.02    0.0004251       562     species                 Escherichia coli
2.318   151     0       14034   1.04    0.002765        219572  species                 Pseudomonas antarctica
0.2763  18      18      2209    1.04    3.857e-05       294     species                   Pseudomonas fluorescens
18.73   1220    1220    148144  1.08    0.03152 1282    species                   Staphylococcus epidermidis
3.853   251     0       61281   1.05    0.02633 1270    species                   Micrococcus luteus
10.04   654     644     42424   1.07    0.002274        550     species                   Enterobacter cloacae
1.167   76      76      16831   1.02    0.0004251       562     species                 Escherichia coli
2.318   151     0       14034   1.04    0.002765        219572  species                 Pseudomonas antarctica
0.2763  18      18      2209    1.04    3.857e-05       294     species                   Pseudomonas fluorescens
18.73   1220    1220    148144  1.08    0.03152 1282    species                   Staphylococcus epidermidis
3.853   251     0       61281   1.05    0.02633 1270    species                   Micrococcus luteus

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.