Code Monkey home page Code Monkey logo

lineardesign's Introduction

Baidu Research Logo

Algorithm for Optimized mRNA Design Improves Stability and Immunogenicity (LinearDesign)

GitHub all releases

This repository contains the source code for the LinearDesign project.

He Zhang†, Liang Zhang†, Ang Lin†, Congcong Xu†, Ziyu Li, Kaibo Liu, Boxiang Liu, Xiaopin Ma, Fanfan Zhao, Huiling Jiang, Chunxiu Chen, Haifa Shen, Hangwen Li*, David H. Mathews*, Yujian Zhang*, Liang Huang†*#. Algorithm for Optimized mRNA Design Improves Stability and Immunogenicity. Nature https://doi.org/10.1038/s41586-023-06127-z (2023)

† contributed equally, * corresponding authors, # lead corresponding author

For questions, please contact the lead corresponding author at [email protected].

Dependencies

Clang 11.0.0 (or above) or GCC 4.8.5 (or above)

python2.7

To Compile

make

To Run

The LinearDesign program can be run with:

echo SEQUENCE | ./lineardesign [OPTIONS]

OR

cat FASTA_FILE | ./lineardesign [OPTIONS]

OPTIONS:

--lambda LAMBDA or -l LAMBDA

Set LAMBDA, a hyperparameter balancing MFE and CAI. (default 0.0)

--codonusage FILE_NAME or -c FILE_NAME

Import a Codon Usage Frequency Table. See "codon_usage_freq_table_human.csv" for the format. (default: using human codon usage frequency table)

--verbose or -v

Print out more details. (default False)

For Macbook, users may encounter a pop-up message at the first run. For Mac-M1 system, the message is:

"LinearDesign_Mac_M1.so" can't be opened because Apple cannot check it for malicious software.

For Mac-Intel system, the message is:

"LinearDesign_Mac_Intel.so" cannot be opened because it is from an unidentified developer.

If so, please go to "System Preferences -> Security & Privacy -> General" to allow LinearDesign-Mac-M1.so (or LinearDesign-Mac-Intel.so) to open.

Example: Single Sequence Design

echo MNDTEAI | ./lineardesign
mRNA sequence:  AUGAACGAUACGGAGGCGAUC
mRNA structure: ......(((.((....)))))
mRNA folding free energy: -1.10 kcal/mol; mRNA CAI: 0.695

Example: Multiple Sequences Design with Option --lambda (-l)

cat testseq | ./lineardesign --lambda 3
>seq1
mRNA sequence:  AUGCCAAACACCCUGGCAUGCCCC
mRNA structure: ((((((.......)))))).....
mRNA folding free energy: -6.00 kcal/mol; mRNA CAI: 0.910

>seq2
mRNA sequence:  AUGCUGGAUCAGGUGAACAAGCUGAAGUACCCAGAGGUGAGCCUGACCUGA
mRNA structure: .....((.((((((..((...(((.......)))..))..))))))))...
mRNA folding free energy: -13.50 kcal/mol; mRNA CAI: 0.979

Example: Option --codonusage (-c)

echo MNDTEAI | ./lineardesign -l 0.3 --codonusage codon_usage_freq_table_yeast.csv
mRNA sequence:  AUGAAUGAUACGGAAGCGAUC
mRNA structure: ......(((.((....)))))
mRNA folding free energy: -1.10 kcal/mol; mRNA CAI: 0.670

Example: Option --verbose (-v)

echo MNDTEAI | ./lineardesign --verbose
Input protein: MNDTEAI
Using lambda = 0; Using codon frequency table = codon_usage_freq_table_human.csv
mRNA sequence:  AUGAACGAUACGGAGGCGAUC
mRNA structure: ......(((.((....)))))
mRNA folding free energy: -1.10 kcal/mol; mRNA CAI: 0.695
Runtime: 0.002 seconds

Declarations

Baidu Research has filed a patent for the LinearDesign algorithm that lists He Zhang, Liang Zhang, Ziyu Li, Kaibo Liu, Boxiang Liu, and Liang Huang as inventors.

lineardesign's People

Contributors

vincentzhangor avatar lineardesignsoftware avatar lianghuang3 avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.