weng-lab / cluster-buster Goto Github PK

Hello, I need a clarification about the input fasta file.

I have to use create_cistarget_databases, that use cluster-buster in order to create a region rank for each motif.

I obtain the fasta file that I will give to cluster-buster, by converting a bed file, which also have the strand field, with bedtools getfasta.
With bedtools you can specify, with the parameter -s, that if the feature occupies the antisense strand, the sequence will be reverse complemented.

My question is: when I convert the bed to fasta, I have to use the -s parameter or cluster-buster check automatically also the reverse complemented strand and so it is not essential to pass the right strand sequence?

Thanks for your help!

Hello,

I know software works for JASPAR formatted motif files, however, can I use this directly on HOMER motifs? Or do you have a tool to convert HOMER motifs for use in cluster buster?

Hi,

My import of the original Cluster-Buster source code with some modification to make it a bit faster can be found here:
https://github.com/ghuls/clusterbuster

• Do not print version info at the start, but at the end.
• Add "-V" option to only print the version (git commit date and ID).
• Do not print sequence names which is being scanned by default:
  • Add "-v" (verbose) option which will revert to the old behavior.'
  • When scanning several thousand regions of around 1kb, it saves 10% of the running time.
• Change "endl" to newlines so not each line is flushed immediately.
• Reformatted all source code files with clang-format.
• Compile binaries with "-march=native" switch and provide option to compile with intel compiler.
  • This allows to use faster instructions (like AVX2 to be used for log1p, exp and log) which can speedup Cluster-Buster up to 60% compared with the original version).

Hi, when I use

cbust -f 4 motif.file seq.fa

it outputs

Sequence should be at least 1 bp long.

I checked and all the sequences in seq.fa are 500bp. I also tried it with 10000bp sequences and got the same result.

I get output when using -f 1 and -f 0, for example:

CLUSTER 1
Location: 214 to 242
Score: 5.82
ABI3VP1_tnt.REM16_col_a_m1: 6.64
TATATGGTATGGCCGGACCAGACCCGTGT
ABI3VP1_tnt.REM16_col_a_m1	214	233	+	8.03	tatatggtatggccggacca
ABI3VP1_tnt.REM16_col_a_m1	215	234	+	8.22	atatggtatggccggaccag
ABI3VP1_tnt.REM16_col_a_m1	218	237	-	7.19	ggtctggtccggccatacca
ABI3VP1_tnt.REM16_col_a_m1	221	240	-	7.3	acgggtctggtccggccata
ABI3VP1_tnt.REM16_col_a_m1	222	241	-	8.82	cacgggtctggtccggccat
ABI3VP1_tnt.REM16_col_a_m1	223	242	-	9.55	acacgggtctggtccggcca

My motif file:

>ABI3VP1_tnt.REM16_col_a_m1
0.223140	0.016529	0.041322	0.719008
0.136364	0.045455	0.045455	0.772727
0.603306	0.028926	0.136364	0.231405
0.095041	0.528926	0.041322	0.334711
0.107438	0.016529	0.570248	0.305785
0.078512	0.004132	0.309917	0.607438
0.000000	0.004132	0.024793	0.971074
0.000000	0.004132	0.000000	0.995868
0.004132	0.008264	0.000000	0.987603
0.000000	0.008264	0.000000	0.991736
0.020661	0.008264	0.942149	0.028926
0.049587	0.000000	0.946281	0.004132
0.000000	0.975207	0.000000	0.024793
0.024793	0.000000	0.971074	0.004132
0.008264	0.000000	0.991736	0.000000
0.128099	0.004132	0.867769	0.000000
0.995868	0.004132	0.000000	0.000000
0.995868	0.004132	0.000000	0.000000
0.991736	0.000000	0.008264	0.000000
0.904959	0.033058	0.000000	0.061983

Any ideas what might be going on?

To promote reproducible science, could you please use git tags. We require tagged releases when building scientific software. Pulling from the master is not reproducible.

I would also recommend using the standard for semantic versioning. (Semver)[https://semver.org/]
Version number in the form: Magor.Minor.Patch. Please do not
follow the git examples by putting a "v" as the leading character. Github will create a "release" when the tag is pushed.

Thank you for making your software available

git tag -a 1.0.0 -m "release note"
git push --tags