timolassmann / tagdust Goto Github PK
View Code? Open in Web Editor NEWA tool to extract mappable reads from various library preparation protocols.
License: GNU General Public License v3.0
A tool to extract mappable reads from various library preparation protocols.
License: GNU General Public License v3.0
hi i have a problem.
Making all in src
make[1]: Entering directory '/disk5/lyc/biosoft/tagdust-master/src'
make all-am
make[2]: Entering directory '/disk5/lyc/biosoft/tagdust-master/src'
gcc -O2 -funroll-loops -Wall -std=gnu99 -o tagdust tagdust-kslib.o tagdust-main.o tagdust-interface.o tagdust-nuc_code.o tagdust-misc.o tagdust-io.o tagdust-barcode_hmm.o tagdust-calibrateQ.o tagdust-test_architectures.o -lpthread -lm
/usr/bin/ld: tagdust-nuc_code.o:(.bss+0x20): multiple definition of nuc_code'; tagdust-main.o:(.bss+0x20): first defined here /usr/bin/ld: tagdust-nuc_code.o:(.bss+0x0): multiple definition of
rev_nuc_code'; tagdust-main.o:(.bss+0x0): first defined here
/usr/bin/ld: tagdust-misc.o:(.bss+0xfa00): multiple definition of rev_nuc_code'; tagdust-main.o:(.bss+0x0): first defined here /usr/bin/ld: tagdust-misc.o:(.bss+0xfa20): multiple definition of
nuc_code'; tagdust-main.o:(.bss+0x20): first defined here
/usr/bin/ld: tagdust-io.o:(.bss+0x20): multiple definition of nuc_code'; tagdust-main.o:(.bss+0x20): first defined here /usr/bin/ld: tagdust-io.o:(.bss+0x0): multiple definition of
rev_nuc_code'; tagdust-main.o:(.bss+0x0): first defined here
/usr/bin/ld: tagdust-barcode_hmm.o:(.bss+0x20): multiple definition of nuc_code'; tagdust-main.o:(.bss+0x20): first defined here /usr/bin/ld: tagdust-barcode_hmm.o:(.bss+0x0): multiple definition of
rev_nuc_code'; tagdust-main.o:(.bss+0x0): first defined here
/usr/bin/ld: tagdust-test_architectures.o:(.bss+0x0): multiple definition of rev_nuc_code'; tagdust-main.o:(.bss+0x0): first defined here /usr/bin/ld: tagdust-test_architectures.o:(.bss+0x20): multiple definition of
nuc_code'; tagdust-main.o:(.bss+0x20): first defined here
collect2: error: ld returned 1 exit status
make[2]: *** [Makefile:788: tagdust] Error 1
make[2]: Leaving directory '/disk5/lyc/biosoft/tagdust-master/src'
make[1]: *** [Makefile:668: all] Error 2
make[1]: Leaving directory '/disk5/lyc/biosoft/tagdust-master/src'
make: *** [Makefile:352: all-recursive] Error 1
Hi,
I'm trying to use tagdust on the simplest toy example I can imagine, but always get a core dump result.
Can you tell me what I'm doing wrong ?
Thank you.
Command:
./tagdust -1 B:AACGCTTC -2 R:N sample.fasta -o test
Input sequences (sample.fasta):
>M00234:812:000000000-J36YP:1:1102:17688:2041 1:N:0:GAGTGG
AAAACGCTTCCTTCCGGTACACTTACCATGTTACGACTTGTCTCCTCTATATAAATGCGTAGGGGTTTTAGTTAAATGTCCTTTGAAGTATACTTGAGGAGAGTGACGGGCGGTGTGAAGCGTTG
As you can see, the barcode is present at the 3rd position of the input sequence.
But I got this error:
$ ./tagdust -1 B:AACGCTTC -2 R:N sample.fasta -o test
[2020-05-22 12:08:27] Tagdust 2.32, Copyright (C) 2013-2019 Timo Lassmann <[email protected]>
[2020-05-22 12:08:27] cmd: ./tagdust -1 B:AACGCTTC -2 R:N -o test /home/ben/Dropbox/SPYGEN/DEMUX_TESTS/vsearc_merged_sample.fasta
[2020-05-22 12:08:27] Start Run
--------------------------------------------------
[2020-05-22 12:08:27] Determining threshold for read0.
[2020-05-22 12:08:39] Long sequence found. Need to realloc model...
[2020-05-22 12:09:13] Selected Threshold:: 0.513514
Segmentation fault (core dumped)
tagdust segfaults when output files exists already.
It crashes in the free_read_structure(param->read_structure)
call for read_structure->numseq_in_segment[0]
:
$ tagdust -t 8 -e 0.1 -1 O:N -2 S:ACTCGAGCCGAGCAGGCGCGCCGATC -3 R:NNNNNNNNNNNNNNNNN -4 S:GGACCGGG -5 O:N -o test test.fastq.gz
[2019-12-19 17:13:02] Tagdust 2.32, Copyright (C) 2013-2019 Timo Lassmann <[email protected]>
[2019-12-19 17:13:02] cmd: tagdust -t 8 -e 0.1 -1 O:N -2 S:ACTCGAGCCGAGCAGGCGCGCCGATC -3 R:NNNNNNNNNNNNNNNNN -4 S:GGACCGGG -5 O:N -o test test.fastq.gz
[2019-12-19 17:13:02] Start Run
--------------------------------------------------
[2019-12-19 17:13:03] Determining threshold for read0.
[2019-12-19 17:13:08] Long sequence found. Need to realloc model...
[2019-12-19 17:13:47] Selected Threshold:: 0.015063
1
[2019-12-19 17:14:39] ERROR: some output files already exists.
2
free_param: 1
free_param: 2
free_read_structure: 1
free_read_structure: 1 loop: 0
free_read_structure: 1 loop: 0 read_structure->numseq_in_segment
free_read_structure: 1 loop: 0 0
free_read_structure: 1 loop: 0 0 freed
free_read_structure: 1 loop: 1
free_read_structure: 1 loop: 1 read_structure->numseq_in_segment
free_read_structure: 1 loop: 1 0
free_read_structure: 1 loop: 1 0 freed
free_read_structure: 1 loop: 1 1
free_read_structure: 1 loop: 1 1 freed
free_read_structure: 1 loop: 2
free_read_structure: 1 loop: 2 read_structure->numseq_in_segment
free_read_structure: 1 loop: 2 0
free_read_structure: 1 loop: 2 0 freed
free_read_structure: 1 loop: 3
free_read_structure: 1 loop: 3 read_structure->numseq_in_segment
free_read_structure: 1 loop: 3 0
free_read_structure: 1 loop: 3 0 freed
free_read_structure: 1 loop: 3 1
free_read_structure: 1 loop: 3 1 freed
free_read_structure: 1 loop: 4
free_read_structure: 1 loop: 4 read_structure->numseq_in_segment
free_read_structure: 1 loop: 4 0
free_read_structure: 1 loop: 4 0 freed
free_read_structure: 2
free_read_structure: 3
free_read_structure: 4
free_read_structure: 5
free_read_structure: 6
free_param: 3
free_param: 3.1
free_read_structure: 1
free_read_structure: 1 loop: 1
Segmentation fault (core dumped)
"Debugging" code:
diff --git a/src/interface.c b/src/interface.c
index e18a80d..98ad7d6 100644
--- a/src/interface.c
+++ b/src/interface.c
@@ -710,6 +710,7 @@ int free_param(struct parameters* param)
char logfile[200];
FILE* outfile = 0;
int i,status;
+ printf("free_param: 1\n");
//if(param->log){
if(param->outfile){
sprintf (logfile, "%s_logfile.txt",param->outfile);
@@ -723,6 +724,7 @@ int free_param(struct parameters* param)
fclose(outfile);
}
+ printf("free_param: 2\n");
if(param->read_structures){
for(i = 0; i < param->infiles;i++){
if(param->read_structures[i]){
@@ -731,24 +733,35 @@ int free_param(struct parameters* param)
}
MFREE(param->read_structures);
}
+ printf("free_param: 3\n");
if(param->read_structure){
+ printf("free_param: 3.1\n");
free_read_structure(param->read_structure);
+ printf("free_param: 3.2\n");
}
+ printf("free_param: 4\n");
if(param->read_structure_R1){
free_read_structure(param->read_structure_R1);
}
+ printf("free_param: 5\n");
if(param->read_structure_R2){
free_read_structure(param->read_structure_R2);
}
+ printf("free_param: 6\n");
if(param->confidence_thresholds){
MFREE(param->confidence_thresholds);
}
+ printf("free_param: 7\n");
MFREE (param->infile);
+ printf("free_param: 8\n");
MFREE(param->messages);
+ printf("free_param: 9\n");
MFREE(param->buffer);
+ printf("free_param: 10\n");
MFREE(param);
+ printf("free_param: 11\n");
return kslOK;
ERROR:
return status;
@@ -861,20 +874,32 @@ ERROR:
void free_read_structure(struct read_structure* read_structure)
{
int i,j;
+ printf("free_read_structure: 1\n");
for(i = 0; i < 10;i++){
if(read_structure->sequence_matrix[i]){
+ printf("free_read_structure: 1 loop: %d\n", i);
+ if (read_structure->numseq_in_segment) {
+ printf("free_read_structure: 1 loop: %d read_structure->numseq_in_segment\n", i);
+ }
for(j = 0; j < read_structure->numseq_in_segment[i];j++){
+ printf("free_read_structure: 1 loop: %d %d\n", i, j);
MFREE(read_structure->sequence_matrix[i][j]);
+ printf("free_read_structure: 1 loop: %d %d freed\n", i, j);
}
MFREE(read_structure->sequence_matrix[i]);
}
}
+ printf("free_read_structure: 2\n");
MFREE(read_structure->sequence_matrix);
+ printf("free_read_structure: 3\n");
MFREE(read_structure->numseq_in_segment );
+ printf("free_read_structure: 4\n");
MFREE(read_structure->type);
+ printf("free_read_structure: 5\n");
MFREE(read_structure);
+ printf("free_read_structure: 6\n");
}
diff --git a/src/io.c b/src/io.c
index 5381950..4381f46 100644
--- a/src/io.c
+++ b/src/io.c
@@ -799,10 +799,14 @@ int print_all(struct read_info*** read_info_container,struct parameters* param,
i = check_for_existing_demultiplexed_files_multiple(param, num_out_reads);
if(i){
sprintf(param->buffer,"ERROR: some output files already exists.\n");
+ printf("1\n");
param->messages = append_message(param->messages, param->buffer);
+ printf("2\n");
free_param(param);
+ printf("3\n");
exit(EXIT_FAILURE);
}
+ printf("4\n");
filemode[0] = 'w';
filemode[1] = 0;
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.