rth-tools / crispron Goto Github PK

Dears,
I'm trying to predict activity values for sgRNA 23mer only (NGG pam included). But, when I try with a simple test.fasta

>sgrnatest
CATGCTAGCTAGGCTAGCTAGGG

the first error I got is that RNAfold accept a minimum of 30 nucleotides. So, I decided to make up a little bit my test sequence

AAAAAAACATGCTAGCTAGGCTAGCTAGGG

(notice I added Ax7). But the 23mer and 30mer files are empty. Checking the python code is because the PAM position, so I solved by added two more AA at the end and remove two from the begining.

AAAAACATGCTAGCTAGGCTAGCTAGGGAA

The software runs like a charm.

ID,30mer,CRISPRon
sgrnatest_p_7,AAAAACATGCTAGCTAGGCTAGCTAGGGAA,18.25

thus my question are,

• why I need to give a 30mer sequence if my sgRNA is only 20 (23 if pam is included)?
• I know the input is for larger sequences, small genes size or similar, could be a only 23mer sequence input added? at the end the activity prediction is for sgRNA only
• why 23mer file is generated withouth score even though the software works only with 30mer sequences?

thanks very much in advance for your support!.
Sandro

Hi Cripron/off developers,

Thanks a lot for bringing these tools (criprOn/Off) to the community.
In the introduction of using the local command version of these tools, I did see any operation on the reference genomes.
Does this mean it computes relevant scores/metrics without the need for reference genome sequences?

Thanks heaps and I look forward to your reply.

Best,
Huanle