Toxinotype assignment of Clostridium perfringens via ABRicate. C. perfringens has 7 toxinotypes (i.e. A-G) based on the different combinations of toxin genes. A validated/published toxin gene database is included in this repository.

• ABRicate v1.0.1 and its dependencies (will be available using Conda)

Please refer to this section in ABRicate github page: https://github.com/tseemann/abricate#making-your-own-database

$ TOXIper.sh -h

This bash script assigns toxinotypes to C. perfringens genome assemblies using ABRicate v1.0.1 (type will be shown on stdout)
Dependency: ABRicate v1.0.1 with toxinCP database

Usage: ./TOXIper.sh [options] FASTAFILE
Option:
 -h print usage and exit
 -a print author and exit
 -v print version and exit

Version 1.1
Author: Raymond Kiu [email protected] (2020)

A C. perfringens genome assembly in multi-fasta format. One at a time. To give you an idea what a multi-fasta format is:

>Contig1
ATTCGCGAAAGGCCCCCCTTTG
ATGGGGTGTGCCCCCGGTGTGT

It will not work on bugs other than C. perfringens as genes will not be detected.

Toxinotype (e.g. B) will be printed on the stdout

$ TOXIper.sh CP-21.fna 
B

ABRicate BLASTn cutoffs will be set at default, which is minimum nucleotide identity >80% and minimum coverage >80%.

Use > to save outcome into a new file, for example (can be any file name you like)

$ TOXIper.sh CP-21.fna > CP-21.toxinotype

GPLv3

Please report bugs at the issues page so I can respond.

• Please cite this paper if you used the toxin sequence database for toxinotyping.
• Also cite ABRicate as a dependency.

If you use TOXIper for results in your publication, please cite:

• Kiu R, TOXIper: rapid toxinotyping of Clostridium perfringens genomes, GitHub https://github.com/raymondkiu/TOXIper

Raymond Kiu [email protected]