Code Monkey home page Code Monkey logo

emopec's Introduction



                                 ~ ~ EMOPEC ~ ~

            Empirical Model and Oligos for Protein Expression Changes



  > What is EMOPEC?

    EMOPEC is a tool for suggesting changes to DNA sequences to specifically
    alter the expression of proteins. EMOPEC works by replacing the ribosome
    binding site of target proteins.

    An online version available for anyone to use is located at:
    http://emopec.biosustain.dtu.dk/


  > Can I cite it?

    Yes, please and thank you. The paper you should cite is:

    Mads T. Bonde, Margit Pedersen, Michael S. Klausen, Sheila I. Jensen, Tune
    Wulff, Scott Harrison, Alex T. Nielsen, Markus J. Herrgård and Morten O.A.
    Sommer, A novel algorithm based on the comprehensive characterization of the
    Shine-Dalgarno sequence for improved predictable tuning of protein
    expression, Nature Methods (2015)


  > Dependencies?

    EMOPEC is a pure Python library which depends on the ViennaRNA package
    version 2.X. EMOPEC can either use command-line tools or the much faster
    RNAlib python wrappers. Whatever is available will automatically be
    detected.

    See http://www.tbi.univie.ac.at/RNA/ for installation instructions.

    To run the web-interface to EMOPEC locally, the Flask microframework is
    needed. See http://flask.pocoo.org/ for details, but for most systems:

        pip install Flask

    should suffice.


  > Installation?

    Choose any:

        1) $ pip install git+https://github.com/micked/EMOPEC.git

        2) $ git clone https://github.com/micked/EMOPEC.git
           $ cd EMOPEC
           $ python setup.py install


  > How do I use it?

    In Python:

        >>> import emopec
        >>> emopec.get_expression('AGGAGA')
        9.41932973140501

        >>> my_leader = 'ATACAAGTCGCTTAAGGCTTGCCAACGAACCATTGCCGCC'
        >>> upstream, sd_seq, spacing, expr = emopec.predict_spacing(my_leader)
        >>> (upstream, sd_seq, spacing)
        ('ATACAAGTCGCTTAAGGCTTGCCAAC', 'GAACCA', 'TTGCCGCC')
        >>> expr
        1.6219460336049762
        >>> emopec.get_expression(sd_seq, sd_dist=len(spacing))
        1.6219460336049762

        >>> my_cds = 'ATGAAGTTTATCATTAAATTGTTCCCGGAAATCACCATCAAAAGCC'
        >>> lib = emopec.make_library(upstream, sd_seq, spacing, my_cds)
        >>> for vals in lib:
        ...     print('{}: {:.4f} {:.2f}kcal/mol {:.0%}'.format(*vals))
        AGACAT: 2.6361 0.30kcal/mol 40%
        TAGAGT: 3.6126 0.70kcal/mol 55%
        CGAGTG: 4.6015 2.50kcal/mol 70%
        AGAGTA: 5.6119 0.00kcal/mol 86%
        AGGAGT: 6.3893 1.20kcal/mol 98%

    To run the web interface, run:

        $ python emopec/web.py

    and go to localhost:5000 in your browser.


  > Can I share it?

    Not at the moment, since we are currently in the process of discussing which
    license to use for the code.

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.