leffj / helper-code-for-uparse Goto Github PK

I trying to do a simple test , but I don't understand how fasta header are proccess.
For exemple, I have One sample test.fa with the following reads :

>A_sample1
AGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACA
>A_sample2
ATGGTCGTATATATATGGTCGTATATATATGGTCGTATATATATGGTCGTATATATATGGTCGTATATATATGGTCGTATATAT
>A_sample3
ATGGTCGTGTCGTGTCGTGTCGTATATATATCGGTCGTGTCGTGTCGTGTCGTGTCGTATGTCGTGTCGTGTCGTGTCGTATAT
>A_sample4
ATGGTCGTGTCGTGTCGTGTCGTATATATATCGGTCGTGTCGTGTCGTGTCGTGTCGTATGTCGTGTCGTGTCGTGTCGTATAT
>A_sample5
ATACGTGTATGATATGCGGTGTAATACGTGTATGATATGCGGTGTAATACGTGTATGATATGCGGTGTAATACGTGTATGATAT
>A_sample6
ATACGTGTATGATATGCGGTGTAATACGTGTATGATATGCGGTGTAATACGTGTATGATATGCGGTGTAATACGTGTATGATAT
>A_sample7
AGAACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACA
>A_sample8
AGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACA
>A_sample9
AGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACAAGATACA
>A_sample10
ATGGTCGTGTCGTGTCGTGTCGTATATATATCGGTCGTGTCGTGTCGTGTCGTGTCGTATGTCGTGTCGTGTCGTGTCGTATAT
>A_sample11
ATGGTCGTGTCGTGTCGTGTCGTATATATATCGGTCGTGTCGTGTCGTGTCGTGTCGTATGTCGTGTCGTGTCGTGTCGTATAT
>A_sample12
ATGGTCGTGTCGTGTCGTGTCGTATATATATCGGTCGTGTCGTGTCGTGTCGTGTCGTATGTCGTGTCGTGTCGT

I cluster them using :

vsearch --cluster_fast test.fa --id 0.97 --centroids centroids.fa --sizeout --uc test.uc --relabel_sha1 --relabel_keep

Now I want to convert them to biom using your script :

python create_otu_table_from_uc_file.py -i test.uc -o test.biom

I get the following error :

Error in uc file formating. Check for spaces in sample IDs and to make sure there is a semicolon after sample IDs.
First line with issue:
S       0       84      *       *       *       *       *       A1      *
100.0%
Writing table...

I thinks fasta header should keep a rule, but I don't know how... Could you make me a simple exemple to make me understand ?
Thanks

Hi,
I have been trying to make an OTU table after clustering DADA2 ASVs in vsearch. I can create what looks like a reasonable .uc file, but i cant get the create_otu_table_from_uc_file.py to run correctly.

Here is a snippet of my .uc file that I modified to be in your suggested format:
H 7 308 100.0 + 0 0 = ;barcodelabel=Ben; 5a1f583ce79bb0d072ffc8536311b3f5f490491f
H 8 313 100.0 + 0 0 = ;barcodelabel=Ben; fe851df069f6077b51f4709e7ccbd115622b1c53
H 2 313 100.0 + 0 0 = ;barcodelabel=Ben; 59a060b515e6d733f163bbda015c45624963ec6e

Where 'Ben' and then 'Tom' (below, not seen) are dummy sample names. The OTUs are the sha labels, which I could alter if need be.

Anyway, when I run the script I get this error:

Traceback (most recent call last): File "../uc2otu.py", line 95, in <module> main() File "../uc2otu.py", line 32, in main create_otu_table(input_fp, output_fp) File "../uc2otu.py", line 52, in create_otu_table otu = toks[9] IndexError: list index out of range

I thought that the addition of the 'barcodelabel=' would put this in the right format, but clearly I am missing something. Any help would be much appreciated!

Thanks!

First, Can I directly enter the command "create_otu_table_from_uc_file.py' into the python terminal? It does not recognize it. Or do I enter the script under the document, if so, I get this error:

args = parser.parse_args()
usage: [-h] -i INPUT_FP -o OUTPUT_FP
: error: argument -i/--input_fp is required

I am new to this could you please help. I did not get the uc2otutable.py to work and this is my only option.

Thanks for your time

Nidhi

Thanks for creating these scripts!

I'm looking for a faster alternative to uc2otutab.py and am trying to use your script create_otu_table_from_uc_file.py. It throws the Error in uc file formating.

Here is what my .uc file looks like. How can I make it compatible with your script?

H   4   253 100.0   +   0   0   =   sample.1.30.3_2 OTU_5;size=644979;
H   25  253 100.0   +   0   0   =   sample.1.30.3_6 OTU_26;size=139253;
H   355 253 100.0   +   0   0   =   sample.1.30.3_7 OTU_326;size=1868;
H   73  253 99.6    +   0   0   253M    sample.1.30.3_24    OTU_70;size=44508;
H   13  253 100.0   +   0   0   =   sample.1.30.3_27    OTU_15;size=230413;