hosnajabbari / dinoknot Goto Github PK
View Code? Open in Web Editor NEWRNA/DNA/PMO Pseudoknotted Secondary Structure Interaction Prediction Using Relaxed Hierarchical Folding
RNA/DNA/PMO Pseudoknotted Secondary Structure Interaction Prediction Using Relaxed Hierarchical Folding
for loop for energy model
should we check if each program call result match the corresponding input structure restrictions?
./HFold_interacting_multimodel --so "TGGAGCAATTGATAAATATTTGTAGGGTGGTTGGCTAAAATAATTATAATTCCTTTAAAAGAAATTCTACCCACTAAAGTTAATTTAGAAGTAAAATATAATAGAAATCCAATAATATATTCACCAAATGGATTAAGATGTTCATGAATTATCTTCAAAGTGTTAATCGAATAAGTAATGTGTATGCTTTTCTGTTAAAGAGGAAGTTAGAAGATCTGAGCTCTGAGTGGAAGGCGGTAAACCGTTTACTTCAAGAGCTGAGGGCAAAGCAGCCTGACCTAGCTCCTGGACTGACCACTATTGGAGCCTGTAAGTATACTGGATCCCATTCTCTTTGGCTCTAGCTATTTGTTCAAAAGTGCAACTATGAAGTGATGACTGGGTGAGAGAGAAAATTTGTTTCAATTCTAAAGATAGAGATAAACCTTTGTGTTATTGACTGTGCAAAAAGTCTTAGAGTACATTCCTTGGAAATTGACTCTGATTCAAAGTGTTGCATGACAACGGGA" --or "_________________________________________________________________________________________________________________________________________________________________________________________________(((((((((((____________________________________________________________________________________________________________________________)))))))))))__________________________________________________________________________________________________________________________________________________________________________" --st "CAGGAGCTAGGTCAGGCTGCTTTGC" --tr "_________(((___)))_______" --t1 RNA --t2 PMO
_________________________________________________________________________________________________________________________________________________________________________________________________(((((((((((____________________________________________________________________________________________________________________________)))))))))))__________________________________________________________________________________________________________________________________________________________________________....._________(((___)))_______
((((((((((.....((((((...((((((...................(((........)))...)))))).(((((.....))))).....))))))........(((((........(((((..((((((......))))))..((((.(((((.(((.......(((((((((........(((.....(((((((((((........(((((..(((((((((((.((((((....))))))..((((.(((((..((((......)))).....))))).))))....)))))..))))))..(((....))).)))))...)))))))))))...)))))))))))).........))).))))))))).....))))).........((((((((...((....))..))))))))....((((((...((((........))))....))))))....)))))))))).)))))...((((((...............................(((...))))))))).
when we do G'=G1-G, it removes the restrictions from G and call method1(S,G').
After method1, when it checks the result, it says restriction not matched
current broken case:
./HFold_interacting_multimodel --so "GCAACGAUGACAUACAUCGCUAGUCGACGC" --or "(____________________________)" --st "GCAACGAUGACAUACAUCGCUAGUCGACGCGCAACGAUGACAUACAUCGCUAGUCGACGC" --tr "(__________________________________________________________)" --t1 RNA --t2 RNA
(fixed) ./HFold_interacting_multimodel --so "UUGUGAUGUUGUGUUGUUGUGUUUGCAAUUGGUCUG" --or "_______((((((__________))))))_______" --st "GGAUGUGCGACAACACAAUGAAAGGAUCGAAAAAUG" --tr "___((((______))))___________________" --t1 RNA --t2 RNA
./HFold_interacting_multimodel --so "CCACUGCUUUUCUUUGAUGUCCCCAUUUUGUGGAGCCCAUCAACCCCGCCAUUUCGG" --or "_____________________________________________(((______)))" --st "GCAGUGGCAUAAAAAAGCAAAUAAAGGCAUAUAACAGAGGGUUAAUAACA" --tr "__________________________________________________" --t1 RNA --t2 RNA
HFold_interacting_multimodel --so "GAGUAGUUCAGUGGUAGAACACCACCUUGCCAAGGUGGGGGUCGCGGGUUCGAAUCCCGUCUCGGGCGAAAGCCC" --or "_____________________________________(((((___________)))))_________________" --st "GGGUGCGAUGAGAAGAAGAGUAUUAAGGAUUUACUAUGAUUAGCGACUCUAGGAUAGUGAAAGCUAGAGGAUAGUAACCUUAAGAAGGCACUUCGAGCACCC" --tr "((((________________________________________________________________________))))______________________" --t1 RNA --t2 RNA
in emodel_energy_function, it calls get_pmo_usage_percentages.
get_pmo_usage_percentages have this if
if ((i < linker_pos) && (j < linker_pos)) { //if ij on left side of linker
if (strcmp(structure_one_type, OLIGO) == 0) {
*energy_model_one_percentage = 0.5;
*energy_model_two_percentage = 0.5;
} else {
*energy_model_one_percentage = 0.0;
*energy_model_two_percentage = 1.0;
}
} else if ((i > linker_pos+linker_length-1) && (j > linker_pos+linker_length-1)) { //if ij on right side of linker
if (strcmp(structure_two_type, OLIGO) == 0) {
*energy_model_one_percentage = 0.5;
*energy_model_two_percentage = 0.5;
} else {
*energy_model_one_percentage = 0.0;
*energy_model_two_percentage = 1.0;
}
}
what does strcmp(structure_one_type, OLIGO) mean?
why is *energy_model_one_percentage = 0.0; , *energy_model_two_percentage = 1.0; no matter if we are on the left or right side of the linker. Shouldn't it be 1.0 and 0.0 or 0.0 and 1.0 depending which side of the linker we are on?
Also why in the following case, it is 0.25 and 0.75 instead of 0.5 0.5
else if ((i < linker_pos) && (j > linker_pos+linker_length-1)) { //if ij cross the linker
//????????????????????? why not 0.5 0.5
*energy_model_one_percentage = 0.25;
*energy_model_two_percentage = 0.75;
}
size in hairpin
in HFold_interacting.cpp
right now we combine seq1XXXXXseq2 and struct1.....struct2 no matter which sequence/structure is shorter.
But when we setting up the model, we push the shorter sequence's model into the model vector first.
Are we suppose to combine seq1XXXXXseq2 and struct1.....struct2 depending which sequence/structure is shorter as well?
h_common.cpp: int is_empty_structure(char* structure)
current implementation: check if output_structure has [
all the if sequence[i] == X and neighbour cases
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.