fabriziocosta / rase-rna-structural-stability-estimator Goto Github PK
View Code? Open in Web Editor NEWRaSE - Rna structurAl Stability Estimator
RaSE - Rna structurAl Stability Estimator
Do we already have plfold step parallelized? That would be good to support this to have 24core support on the cluster. If it is already working in parallel we need to expose n-cores option to the user interface.
please add a -o,--outfile
argument to write the STDOUT output directly to file...
To get a (super) local comparison score between wild and mutant feature graphs: An option to compare and calculate RaSE score on a sub-graph surrounding the SNP location. This option can be implemented to set vector weight(?) of distant locations to zero.
With a quite high frequency for longer sequences RaSE reports the error below. For this sequence RNAplFold dotplot reports many probable basepairs.
Error in: TTAAAGGAGAAGCCTTCAAACTCCCATAGAGCTAGATGGCTATAACTCATCTCCTCTACTCACCCTTTACTACTACCCCATTTGACCTTTTTGTAGATAACTTAGGGTTTCCATAGATATCTTTTATTAGCTCCAATGCTCCAGGTGCTTTTGTAAGTTATAATTAATTTACTCATATAGGATCCCAAAGGAAATCGCATCGCACAATGGCAGAGTTTCC
Reverting to path graph from sequence
QXcbConnection: Could not connect to display
bash: line 1: 18755 Aborted HOME/Software/RaSE/1.0.0/RaSE/code/RaSE.py --draw -p 0.1 -n 15 --png -c 3 -e 2 -i UGAUGACUGACUG -w 150 -k 5 -r 0.5 -b 130
it seems the "importance window" feature is not documented?!
Suppose the scenario where a sequence of length 1000 and window size is set to 200. For a mutation at position say 300, all the graph features above 500 never get impacted by the mutation. So the Rase-Score is undesirably influenced (decreased?) by extending and increasing the length of sequence beyond the window size.
The desire mode would be to let the user set a context length for the feature generation.
A less complicated option would be to fix the context length to the window size parameter.
I have been using the web tool, but after I checked the heatmap plots in the Jupyter notebook, I had been interested on generate heatmaps like that for a particular sequence I am interested on. I installed RaSE and Eden (the new and previous 2 versions) and I keep having this error:
AttributeErrorTraceback (most recent call last)
<ipython-input-17-306f466e9147> in <module>()
----> 1 rase_stat=rase.stability_score(0,'A')
2 rase_stat2=rase.stability_score(12,'U')
/home/mcortesl/RaSE/code/RaSE.py in stability_score(self, pos, mutation, importance_semi_window)
353 pos=pos,
354 mutation=mutation,
--> 355 fold_vectorize=self.fold_vectorize)
356
357 def compute_stability_scores(self):
/home/mcortesl/RaSE/code/RaSE.py in stability_score(seq, pos, mutation, fold_vectorize)
221 def stability_score(seq, pos=None, mutation=None, fold_vectorize=None):
222 """stability."""
--> 223 vec1 = fold_vectorize([('header_placeholder', seq)])
224 alternative = _make_variation(seq, pos, mutation)
225 vec2 = fold_vectorize([('header_placeholder', alternative)])
/home/mcortesl/.conda/envs/rnastrtools/lib/python2.7/site-packages/toolz/functoolz.pyc in __call__(self, *args, **kwargs)
432 ret = self.first(*args, **kwargs)
433 for f in self.funcs:
--> 434 ret = f(ret)
435 return ret
436
/home/mcortesl/.conda/envs/rnastrtools/lib/python2.7/site-packages/toolz/functoolz.pyc in __call__(self, *args, **kwargs)
279 def __call__(self, *args, **kwargs):
280 try:
--> 281 return self._partial(*args, **kwargs)
282 except TypeError as exc:
283 if self._should_curry(args, kwargs, exc):
/home/mcortesl/RaSE/code/RaSE.py in <lambda>(vec, graphs)
155 """Curry parameters in vectorizer."""
156 vec = Vectorizer(complexity=complexity, nbits=nbits)
--> 157 vectorize = curry(lambda vec, graphs: vec.transform(graphs))(vec)
158
159 cwindow_reweight = curry(_window_reweight)(boundaries)
/home/mcortesl/.conda/envs/rnastrtools/lib/python2.7/site-packages/eden/graph.pyc in transform(self, graphs)
302 instance_id = None
303 feature_rows = []
--> 304 for instance_id, graph in enumerate(graphs):
305 self._test_goodness(graph)
306 feature_rows.append(self._transform(graph))
/home/mcortesl/.conda/envs/rnastrtools/lib/python2.7/site-packages/toolz/functoolz.pyc in __call__(self, *args, **kwargs)
279 def __call__(self, *args, **kwargs):
280 try:
--> 281 return self._partial(*args, **kwargs)
282 except TypeError as exc:
283 if self._should_curry(args, kwargs, exc):
/home/mcortesl/RaSE/code/RaSE.py in _window_reweight(boundaries, original_graph)
135
136 def _window_reweight(boundaries, original_graph):
--> 137 graph = original_graph.copy()
138 if boundaries is not None:
139 begin, end = boundaries
AttributeError: 'generator' object has no attribute 'copy'
I have the feeling that the error is somehow related with networkx, but I already tried installing networkx 1.10 and it doesn't seem to solve the problem. Any advice on how to solve this?
Also, is there any updated installation of RaSE?
this simplifies the extraction of data (otherwise one has to parse out the second column from the file, which is non-trivial for biologists)
Is it possible (and if so how - please add documentation) to restrict the structural change analysis to a user provided window?
this would be especially helpful to design point mutations to change known/putative interaction sites...
line plot
x = sequence + position
y = (1-similarity)
file name
RaSE_OldntPosNewnt.FILEFORMAT
that way we get directly the mutation encoding in column style, which eases copy and paste!?
just a suggestion that we can also drop.. but for bioinformaticians it doesnt make a difference and for all others it might be useful?!
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.