edg1983 / green-varan Goto Github PK
View Code? Open in Web Editor NEWAnnotate non-coding regulatory vars using our GREEN-DB, prediction scores, conservation and pop AF
License: MIT License
Annotate non-coding regulatory vars using our GREEN-DB, prediction scores, conservation and pop AF
License: MIT License
The file
https://zenodo.org/record/5636209/files/GREEN-DB_v2.5.db.gz.csi
does not exist on zenodo, so "nextflow workflow/download.nf " gives error:
HTTP request sent, awaiting response... 301 MOVED PERMANENTLY Location: /records/5636209/files/GREEN-DB_v2.5.db.gz.csi [following] --2023-12-13 12:41:37-- https://zenodo.org/records/5636209/files/GREEN-DB_v2.5.db.gz.csi Reusing existing connection to zenodo.org:443. HTTP request sent, awaiting response... 404 NOT FOUND 2023-12-13 12:41:37 ERROR 404: NOT FOUND.
How to workaround this?
Thanks
Hello!
Thank you so much for the GREEN-VARAN. I think it will perfect for what I need.
I've ran the test script for the test data using:
python GREEN-VARAN.py -i test/VCF/GRCh38.test.snpEff.vcf.gz -o test/out/test_standard.vcf --AF_file /PATH/to/gnomad/gnomad.genomes.r3.0.sites.vcf.bgz -b GRCh38 -m annotate -s ReMM -s NCBoost -s LinSight --threads 4
It is completing the compilation with the final message "Annotation completed: 0 variants written in 0:00:00" and giving no clear error. Do you have any idea why that could be happening?
Thank you very much!
Dear Eduardo,
I started a new issue, because I believe it is not related to our earlier discussion. I am now using the Green-varan workflow configuration. While analyzing data from build GRCh37, having the all scores and regions on, the program wants to annotate the vcf file using GRCh38 recources.
Can you advise? See the error message below.
./GREEN-VARAN/workflow/main.nf
[lethal_majorana] - revision: 539422f1a2input file : ./XX.vcf.gz
build : GRCh37
output : ./results
greenvaran config : ./GREEN-VARAN//config/prioritize_smallvars.json
greenvaran dbschema : ./GREEN-VARAN//config/greendb_schema_v2.5.json
resource folder : ./GREEN-VARAN/workflow/../resources
WARN: Nextflow version 21.10.6 does not match workflow required version: 20.10.0 -- Execution will continue, but things may break!
[- ] process > WRITE_SCORE_TOML -
[- ] process > WRITE_SCORE_TOML -
[- ] process > DOWNLOAD_REGION -
[- ] process > WRITE_REGION_TOML -
[- ] process > WRITE_AF_TOML -
[- ] process > concat_toml -
[- ] process > ANNOTATE:annotate_vcf -
[- ] process > ANNOTATE:index_vcf -
[- ] process > green_varan -
TAD not found at ./GREEN-VARAN/resources/GRCh37/GRCh38_TAD.bed.gz
In addition: A possible cause is that the GRCh37 TAD bed file was missing from my folder. There is an issue with downloading the file and they seem to be missing from the download server. In addition two other files could not be downloaded.
GRCh37_dbSuper | regions | https://zenodo.org/record/5705936/files/GGRCh37_dbSuper.bed.gz.csi
GRCh37_TAD | regions | https://zenodo.org/record/5705936/files/GRCh37_TAD.bed.gz
GRCh37_TAD | regions | https://zenodo.org/record/5705936/files/GRCh37_TAD.bed.gz.csi
Why is the SV chr14_73,085,269_73,141,832_INV not annotated with the promoter 580535_pro (chr14_73,135,539_73,138,139) despite the promoter being fully within the SV region?
Thanks for this helpful tool!
I am having trouble understanding why a particular SV is not annotated with a particular region despite the SV region containing the regulatory region.
The SV I am trying to annotate is an inversion (chr14_73,085,269_73,141,832_INV).
chr14 | 73085269 | MantaINV:113901:0:2:0:0:0 | G | <INV> | 389 | PASS | END=73141832;SVTYPE=INV;SVLEN=56563;CIPOS=0,25;CIEND=-25,0;HOMLEN=25;HOMSEQ=GCCTCCCAAAGTGCTGGGATTACAG;INV3;SVCALLER=MANTA;INV5 | GT:FT:GQ:PL:PR:SR
I checked GREEN-DB, and the promoter 580535_pro (chr14_73,135,539_73,138,139) is fully contained within the inverted region.
580535_pro | chr14 | 73135539 | 73138139 | active_promoter,promoter | promoter | BENGI,DECRES,FOCS,ENCODE-HMM | deep_learning,HMM_prediction,roadmap | 0.129 | 0.620575 | PSEN1 | PSEN1 | 0 | PSEN1 | 0 | GM12878,HMEC,HUVEC,HelaS3,HepG2,K562,H1-hESC,HSMM,NHEK,NHLF | Sporadic,Bilateral tonic-clonic seizure,Primitive reflex,Alexia,Mutism,Abulia,Abnormality of vision,Memory impairment,Restlessness,Seizure,Language impairment,Cerebral cortical atrophy,Inappropriate laughter,Dysphasia,Senile plaques,Abnormality of the cerebral white matter,Visual agnosia,Neurofibrillary tangles,Abnormal lower motor neuron morphology,Hypertonia,Parkinsonism,Abnormality of neutrophils,Brain atrophy,Depressivity,Abnormal brain FDG positron emission tomography,Grammar-specific speech disorder,Aphasia,Anomia,Dyslexia,Anxiety,Motor aphasia,Hyperorality,Congestive heart failure,Lack of insight,Poor speech,Elevated serum creatine kinase,Abnormality of extrapyramidal motor function,Agnosia,Spoken Word Recognition Deficit,EEG with continuous slow activity,Dysgraphia,Spastic tetraparesis,Alzheimer disease,EMG abnormality,Frontotemporal dementia,Neuronal loss in central nervous system,Restrictive behavior,Semantic dementia,Fasciculations,Thickened nuchal skin fold,Frontotemporal cerebral atrophy,Echolalia,Inappropriate behavior,Palmoplantar keratoderma,Astrocytosis,Babinski sign,Hyperreflexia,Abnormal social behavior,Apraxia,Intellectual disability,Personality changes,Agitation,Dilated cardiomyopathy,Perifolliculitis,Optic ataxia,Irritability,Acne inversa,Frontal lobe dementia,Temporal cortical atrophy,Adult onset,Polyphagia,Gait disturbance,Dementia,Heterogeneous,Myopathy,Confusion,Finger agnosia,Lipoatrophy,Perseveration,Psychosis,Loss of speech,Upper motor neuron dysfunction,Chronic furunculosis,Syncope,Dystonia,Amyotrophic lateral sclerosis,Dyscalculia,Collectionism,Deposits immunoreactive to beta-amyloid protein,Dysphagia,Disinhibition,Recurrent cutaneous abscess formation,Myoclonus,Sensorineural hearing impairment,Hallucinations,Stereotypy,Oculomotor apraxia,Ataxia,Emotional blunting,Inappropriate sexual behavior,Lower limb hyperreflexia,Autosomal dominant inheritance,Apathy,Rapidly progressive,Gliosis,Dysarthria,Aggressive behavior
However, the SV is not annotated with this promoter. There are some other regulatory regions contained in the inverted region (e.g., 145783_pro at chr14:73,137,653-73,137,980), but these are also not added to the annotations.
The SV is only annotated with 417710_enh (chr14:73,084,745-73,092,455).
greenvaran sv \
-i input.vcf \
-o output.vcf \
-d GRCh38_GREEN-DB.bed.gz \
-s greendb_schema_v2.5.json \
-g gene_list.txt \
-p 1
I was confused with the annotated results, here is the example which labled as greendb_level=3. But I don't know which three levels satisfy threshold. Was these three levels: MAF<1%; overlap with DNase andTFBS; greendb_constraint=0.722409>0.7. The ReMM=0.538 and ncER=85.5791 were not satisfy FDR50 threshold?
Thank you for your kindly help.
AC=1;AF=0.5;AN=2;BaseQRankSum=0.12;ClippingRankSum=-0;DP=9;ExcessHet=3.0103;FS=7.782;MLEAC=1;MLEAF=0.5;MQ=60;MQRankSum=-0;QD=10.64;ReadPosRankSum=-0;SOR=3.611;VQSLOD=22.3209;culprit=MQ;FATHMM_MKLNC=0.1036;ReMM=0.538;ncER=85.5791;DNase;TFBS;gnomAD_AF=0.005553;gnomAD_AF_afr=0.0053394;gnomAD_AF_amr=0.0048544;gnomAD_AF_nfe=0.0046707;greendb_id=561490_pro,2_biv,505745_pro;greendb_stdtype=bivalent,promoter;greendb_dbsource=FOCS,SegWey,ENCODE-HMM,BENGI,EnsemblRegBuild,FANTOM5;greendb_genes=RBP7;greendb_constraint=0.722409;greendb_level=3;ANN=C|promoter|MODIFIER|RBP7||||||||||||,C|bivalent|MODIFIER|RBP7||||||||||||
Dear Edoardo,
How we can add and use tissue expression data in annotated VCF file?
Regards,
Najeeb
Hi,
Thank you for providing such a wonderful tool, combining so many tools to help in prioritizing non-coding variants.
I am trying to run the GREEN-VARAN on a GRCh37 dataset. However, our reference genome labels the chromosomes as 1, 2, 3, etc.
GREEN-VARAN seems to expect chr1, chr2, chr3, etc. Is there an option to change this? I found the utils.nim file listing STDCHROMS, but changing the list there didn't change anything.
In addition, is there also a GRCh37 test vcf available?
Regards,
Lennart Johansson
Dear Edoardo,
I want to use GREEN-VARAN workflow to prioritize variants.
I tried to GREEN-VARAN work flow on test vcf file "GRCh38.test.smallvars.tmp.vcf.gz".
/home/moon9319/nextflow /home/moon9319/GREEN-VARAN/workflow/main.nf
-profile local
--input $DataPath$VCF_FILE
--build GRCh38
--out /home/moon9319/SNV/02.WORKFLOW/
--scores best
--regions best
--AF
--greenvaran_config /home/moon9319/GREEN-VARAN/config/prioritize_smallvars.json
--greenvaran_dbschema /home/moon9319/GREEN-VARAN/config/greendb_schema_v2.5.json
############################
executor > local (11)
[99/1943af] process > WRITE_SCORE_TOML (2) [100%] 3 of 3 ✔
[f7/37a2bf] process > WRITE_REGION_TOML (2) [100%] 3 of 3 ✔
[69/207667] process > WRITE_AF_TOML (1) [100%] 1 of 1 ✔
[c6/ec0a86] process > concat_toml [100%] 1 of 1 ✔
[ea/e32acb] process > ANNOTATE:annotate_vcf (1) [100%] 1 of 1 ✔
[5f/8128e9] process > ANNOTATE:index_vcf (1) [100%] 1 of 1 ✔
[0e/609915] process > green_varan (1) [100%] 1 of 1, failed: 1 ✘
[2022-06-13T10:38:41] - INFO: Reading config from file: prioritize_smallvars.json
[2022-06-13T10:38:41] - INFO: N selected chromosomes: 25
[2022-06-13T10:38:41] - INFO: N selected genes: 0
[2022-06-13T10:38:41] - INFO: Update existing gene annotations: true
[2022-06-13T10:38:41] - INFO: Filter mode active: false
[2022-06-13T10:38:41] - INFO: === Start processing VCF ===
Command error:
[E::bcf_hdr_read] Input is not detected as bcf or vcf format
/project/alfredo/GAU_tools/GREEN-VARAN/src/greenvaran.nim(40) greenvaran
/project/alfredo/GAU_tools/GREEN-VARAN/src/greenvaran.nim(37) main
/project/alfredo/GAU_tools/GREEN-VARAN/src/greenvaran/smallvars.nim(99) main
/project/alfredo/software/nim_packages/pkgs/hts-0.3.21/hts/vcf.nim(238) open
Error: unhandled exception: [hts-nim/vcf] error reading VCF header from 'GRCh38.test.smallvars.tmp.vcf.gz' [OSError]
########################################
but I think there are any problem in Annotate step without error-message.
tmp vcf file(input of green_varan) in ANNOTATE:annotate_vcf is empty.
what shold I do to fix it ?
Thank you!
Hi,
I got an error as below when I ran workflow/main.nf. Do you know what has gone wrong.
N E X T F L O W ~ version 22.10.2
Launching /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/workflow/main.nf
[irreverent_swanson] DSL2 - revision: ad29e3fa07
Available datasets. Star indicate corresponding file is available locally
=== SCORES ===
CADD: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_CADD.tsv.gz
DANN: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_DANN.tsv.gz
Eigen: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_Eigen.tsv.gz
ExPECTO: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_ExPECTO.tsv.gz
FATHMM_MKLNC: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_FATHMM-MKL_NC.tsv.gz
FATHMM_XF: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_FATHMM-XF_NC.tsv.gz
FIRE: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_FIRE.tsv.gz
GWAVA: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_gwava.bed.gz
LinSight: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_LinSight.bed.gz
NCBoost: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_NCBoost.tsv.gz
ncER: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_ncER_perc.bed.gz
PhyloP100: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_PhyloP100.bed.gz
ReMM: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_ReMM.tsv.gz
=== REGIONS ===
TFBS: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_TFBS.merged.bed.gz
DNase: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_DNase.merged.bed.gz
UCNE: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_UCNE.bed.gz
dbSuper: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/resources/GRCh37/GRCh37/GRCh37_dbSuper.bed.gz
=== GNOMAD AF ===
Cannot get property 'file' on null object
Dear Edoardo,
I have been attempting to run the Nextflow workflow on a VCF file (and on the test file provided within the package), however regardless of version of nextflow (I have used both v20.10.0 and 23.04.3), I receive the following errors:
WARN: Access to undefined parameter
annotations
-- Initialise it to a default value eg.params.annotations = some_value
Cannot get property 'GRCh38' on null object
I am not sure where I need to amend the code to fix this issue (I have used the same code given in the example workflow) and did check one of the other issues raised on gitHub, however the provided command on the "workflow green_varan failed #8" issue thread did not run for me either.
I would appreciate any support with this matter.
Thank you,
Safaa
I want to use GREEN-VARAN workflow to annotate regulation variants. Rare variant (population AF < 1%) overlapping one of GREEN-DB regions was defined as greendb_level=1, whereas the variant with population AF > 1% was also defined as greendb_level=1 in my VCF file. Any change of GREEN-VARAN compare to previous version in your paper?
This is one example:AC=1;AF=0.125;AN=2;BaseQRankSum=-1.981;DP=18;ExcessHet=3.0103;FS=0;MLEAC=1;MLEAF=0.125;MQ=40;MQRankSum=0;QD=6.73;ReadPosRankSum=0;SOR=0.892;ReMM=0.486;ncER=74.0135;FATHMM_MKLNC=0.9039;TFBS;gnomAD_AF=0.7122;gnomAD_AF_afr=0.3236;gnomAD_AF_amr=0.7951;gnomAD_AF_nfe=0.8539;greendb_id=42036_pro;greendb_stdtype=promoter;greendb_dbsource=ENCODE-HMM;greendb_genes=AL669831.3,OR4F16,CICP3;greendb_level=1;ANN=A|promoter|MODIFIER|CICP3||||||||||||,A|promoter|MODIFIER|AL669831.3||||||||||||,A|promoter|MODIFIER|OR4F16||||||||||||
Dear developer,
I have successfully config everything and ran the test file but failed to run my one file. Do you know what has gone wrong? Many thanks in advance!
test run
[2023-11-15T12:59:21] - INFO: Reading config from file: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/config/prioritize_smallvars.json
[2023-11-15T12:59:21] - INFO: N selected chromosomes: 25
[2023-11-15T12:59:21] - INFO: N selected genes: 23
[2023-11-15T12:59:21] - INFO: Update existing gene annotations: true
[2023-11-15T12:59:21] - INFO: Output to: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/test/out/test_smallvars.vcf
[2023-11-15T12:59:21] - INFO: Filter mode active: false
[2023-11-15T12:59:21] - INFO: === Start processing VCF ===
[2023-11-15T12:59:21] - WARN: gnomAD_AF field defined in config not present in the VCF header
[2023-11-15T12:59:21] - WARN: gnomAD_AF_nfe field defined in config not present in the VCF header
[2023-11-15T12:59:21] - WARN: TFBS field defined in config not present in the VCF header
[2023-11-15T12:59:21] - WARN: DNase field defined in config not present in the VCF header
[2023-11-15T12:59:21] - WARN: UCNE field defined in config not present in the VCF header
[2023-11-15T12:59:21] - WARN: FATHMM_MKLNC field defined in config not present in the VCF header
[2023-11-15T12:59:21] - WARN: ncER field defined in config not present in the VCF header
[2023-11-15T12:59:21] - WARN: ReMM field defined in config not present in the VCF header
[2023-11-15T12:59:21] - WARN: Prioritize is not active and all variants will get level zero
[2023-11-15T12:59:47] - INFO: 10000 vars analyzed, last batch in 0.0 min 25.39 sec
[2023-11-15T13:00:14] - INFO: 20000 vars analyzed, last batch in 0.0 min 27.15 sec
[2023-11-15T13:00:21] - INFO: 12497 variants annotated with greendb information
[2023-11-15T13:00:21] - INFO: 35 vars of interest based on the input gene list if any
[2023-11-15T13:00:21] - INFO: 24000 variants written to output
[2023-11-15T13:00:21] - INFO: All done - Completed in 0.0 min 59.84 sec
actual run
[2023-11-15T12:48:29] - INFO: Reading config from file: /proj/sens2023551/wgs_nes/GREEN-VARAN-1.2/config/prioritize_smallvars.json
[2023-11-15T12:48:29] - INFO: N selected chromosomes: 25
[2023-11-15T12:48:29] - INFO: N selected genes: 1
[2023-11-15T12:48:29] - INFO: Update existing gene annotations: true
[2023-11-15T12:48:29] - INFO: Output to: /proj/sens2023551/wgs_nes/Green_annotation/All_G1A_gatkcomb_rhocall_vt_af_frqf_cadd_vep_parsed_ranked.selected.green.vcf.gz
[2023-11-15T12:48:29] - INFO: Filter mode active: false
[2023-11-15T12:48:29] - INFO: === Start processing VCF ===
[2023-11-15T12:48:29] - WARN: gnomAD_AF field defined in config not present in the VCF header
[2023-11-15T12:48:29] - WARN: gnomAD_AF_nfe field defined in config not present in the VCF header
[2023-11-15T12:48:29] - WARN: TFBS field defined in config not present in the VCF header
[2023-11-15T12:48:29] - WARN: DNase field defined in config not present in the VCF header
[2023-11-15T12:48:29] - WARN: UCNE field defined in config not present in the VCF header
[2023-11-15T12:48:29] - WARN: FATHMM_MKLNC field defined in config not present in the VCF header
[2023-11-15T12:48:29] - WARN: ncER field defined in config not present in the VCF header
[2023-11-15T12:48:29] - WARN: ReMM field defined in config not present in the VCF header
[2023-11-15T12:48:29] - WARN: Prioritize is not active and all variants will get level zero
[2023-11-15T12:48:29] - WARN: No ANN or BCSQ field detected in header so ANN will be created
[2023-11-15T12:48:29] - INFO: 0 variants annotated with greendb information
[2023-11-15T12:48:29] - INFO: 0 vars of interest based on the input gene list if any
[2023-11-15T12:48:29] - INFO: 0 variants written to output
[2023-11-15T12:48:29] - INFO: All done - Completed in 0.0 min 0.07 sec
Hello! Thank for having developed GREEN-VARAN
I've tried to run the workflow with the test data using:
main.nf -profile local --input ./test/VCF/GRCh38.test.smallvars.vcf.gz
--build GRCh38 --
out results --scores best --regions best --AF
--greenvaran_config config/prioritize_smallvars.json
--greenvaran_dbschema config/greendb_schema_v2.5.json
It seems to work (no error message) but when I look at the annotated vcf I've got only two annotated variants whereas the initial vcf contains several thousands of variants.
I've also tried with a vcf I want to annotate and the output vcf is empty (it contains only the header).
Do you have an idea of what goes wrong?
Thank you
Hi Edoardo,
I've downloaded the binaries and all the GRCh38 files
When I try to run the test I get the following error:
`$ ./greenvaran smallvars -i test/VCF/GRCh38.test.smallvars.vcf.gz -o test/out/test_smallvars.vcf --db resources/GRCh38/GRCh38_GREEN-DB.bed.gz --dbschema config/greendb_schema_v2.5.json --config config/prioritize_smallvars.json --genes test/VCF/genes_list_example.txt
/ )( _ ( )( )( ( \ ___ / )( \ / \ ( _ \ / \ ( ( \
( ( \ ) / ) ) ) ) / /()\ / // \ ) // / /
_/(_)()()_)) __/ _/_/(_)_/_/_))
_.-~` `~-.
_.--~~~---,.__ _.,;; . -=(@'`\\
.-` ``~~~~--~~` ';;; ____)
_.' '. ';;;;; '`_.'
.-~;` `\ ' ';;;;;__.~`
.' .' `'. | / /;''
\/ .---'' ``) /'-._____.--'\ \\
_/| (` / /` `\ \__
', /- \ \ __/ (_ /-\-\-
;'-..___) |
/---
-. .'
jgs `~~~~``
[2023-12-18T13:10:55] - INFO: Reading config from file: config/prioritize_smallvars.json
[2023-12-18T13:10:55] - INFO: N selected chromosomes: 25
[2023-12-18T13:10:55] - INFO: N selected genes: 23
[2023-12-18T13:10:55] - INFO: Update existing gene annotations: true
[2023-12-18T13:10:55] - INFO: Filter mode active: false
[2023-12-18T13:10:55] - INFO: === Start processing VCF ===
[2023-12-18T13:10:55] - WARN: gnomAD_AF field defined in config not present in the VCF header
[2023-12-18T13:10:55] - WARN: gnomAD_AF_nfe field defined in config not present in the VCF header
[2023-12-18T13:10:55] - WARN: TFBS field defined in config not present in the VCF header
[2023-12-18T13:10:55] - WARN: DNase field defined in config not present in the VCF header
[2023-12-18T13:10:55] - WARN: UCNE field defined in config not present in the VCF header
[2023-12-18T13:10:55] - WARN: FATHMM_MKLNC field defined in config not present in the VCF header
[2023-12-18T13:10:55] - WARN: ncER field defined in config not present in the VCF header
[2023-12-18T13:10:55] - WARN: ReMM field defined in config not present in the VCF header
[2023-12-18T13:10:55] - WARN: Prioritize is not active and all variants will get level zero
strutils.nim(1159) parseFloat
Error: unhandled exception: invalid float: FO704657.1 [ValueError]
`
what is going wrong?
Thanks
Hi @edg1983, I was wondering if you could consider adding a parameter to set the maximum size of SV to annotate?
Some callers report extremely large SVs which are likely to be spurious (e.g., an inversion with SVLEN=153641285
). When these large SVs get annotated with all overlapping regulatory regions, the output file can be quite cumbersome. It would be nice if I could choose to annotate only SVs less than 1 Mb, for example.
What do you think?
A declarative, efficient, and flexible JavaScript library for building user interfaces.
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google ❤️ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.