Code Monkey home page Code Monkey logo

debar's Introduction

debar

DEnoise BARcode data with profile hidden Markov models

codecov License: GPL v3 CRAN_Status_Badge Generic badge

debar is an R package designed for denoising sequence data for the animal DNA barcode marker: cytochrome c oxidase I (COI-5P, or the five prime portion of COI). The package is designed to detect and correct insertion and deletion errors within barcode sequences. This is accomplished through comparison of input sequences against a profile hidden Markov (PHMM) model using the Viterbi algorithm and adjustment of the sequence based on the reported Viterbi path (debar depends on functions from the R package aphid for the PHMM structure and for running the Viterbi algorithm).

Inserted base pairs are removed and deleted base pairs are accounted for through the introduction of a placeholder character. Since the PHMM is a probabilistic representation of the COI barcode, corrections are not always perfect. For this reason debar censors base pairs adjacent to reported indel sites, turning them into placeholder characters (default is 7bp in either direction, this feature can be disabled). Testing has shown that this censorship results in the correct sequence length being restored and erroneous base pairs being masked the vast majority of the time (>95%). Multiple denoised and censored reads from a sample can then be combined to obtain a full, denoised barcode.

Intended use

The debar denoising method is designed to increase the accuracy of reported barcode sequences. It is therefore best applied when the accuracy of a barcode is paramount, namely in the generation of novel barcode sequences. In the case of metabarcoding analysis debar can allow for denoised haplotypes to be obtained for operational taxonomic units (OTUs).

The package was initially designed for processing single molecule real-time (SMRT) sequencing outputs produced by the Pacific Biosciences SEQUEL platform. However, the method is barcode-based (as opposed to sequencer-based) and should therefore be robust to COI sequence data of any origin. If you intend to apply debar in the denoising of metabarcode data, it is recommended that you do so after quality filtering and dereplication of reads. Please consult the package vignette for recommended parameters and examples of integration into barcoding and metabarcoding workflows.

Installation

debar can be installed directly from CRAN.

install.packages("debar")
library(debar)

The development version of debar can be installed directly from GitHub. You'll need to have the R package devtools installed and loaded. Also note if the build_vignettes option is set to true, you will need to have the R package knitr installed.

#install.packages("devtools")
#install.packages("knitr") #required if build_vignettes = TRUE
#library(devtools) 
devtools::install_github("CNuge/debar", build_vignettes = TRUE)
library(debar)

Use and examples

The package's vignette contains detailed explanations of the functions and parameters of the debar denoising pipeline. The user is encouraged to read this document in order to get oriented and effectively deploy debar in the denoising of their own data. Following package installation, the vignette can be accessed from within R through the following command:

vignette('debar-vignette')

A second vignette, with a detailed explanation of the denoising process is also included:

vignette('debar-algorithm-details')

Denoising within R

debar can be used to perform denoising of sequences from within R. The denoise function can be used to process a single read and (optionally) its associated quality information as well.

#read a file of example sequences 
#fastq
fastq_example_file = system.file('extdata/coi_sequel_data_subset.fastq', package = 'debar')
data = read_fastq(fastq_example_file)

#denoise a given read
denoised_seq = denoise(data$sequence[[1]], 
                      name = data$header_data[[1]],
                      quality = data$quality[[1]], 
                      to_file = FALSE)
?denoise # for an exhaustive list of parameter options.
names(denoised_seq) # for list of available object components

This will produce a DNAseq object, from which detailed information related to a given read can be accessed using the dollar sign notation.

Batch processing

A list of sequences for a given haplotype can be denoised using the denoise_list function. This is an especially useful feature for tasks such as denoising sequences in an OTU prior to determining the consensus sequence, or in obtaining common haplotypes for an OTU. The denoise_list function is parallelized and can be run acrosss multiple cores (specify the number available with the cores argument)

# ex_nt_list is an example list of four barcode sequences that contain errors.
ex_out = denoise_list(ex_nt_list, cores = 2)

Optionally, when multiple sequences are available from a given sample (or OTU) they can be denoised as a group. Passing the keep_flanks=FALSE option to the function will produce denoised outputs with a common reading frame (leading placeholder Ns are added as needed). The consensus_sequence function can then be used to obtain a consensus from the denoised sequences.

ex_out = denoise_list(ex_nt_list, keep_flanks=FALSE)
ex_out #each output individually has some missing information
barcode_seq = consensus_sequence(ex_out)
barcode_seq #aligned through the denoising process, a consensus without missing information can be obtained

File-to-file denoising

Denoising of COI-5P barcode data with debar can be conducted in a file-to-file fashion using the denoise_file function.

All a user needs to do is specify the input and output files and as well as any deviations from the default parameters they wish to apply (see ?denoise or the manual for exhaustive parameter list). The sequences in the input file will be denoised and written to the output file in the specified format. The denoise_file function accepts barcode data in either fastq or fasta formats (gzipped (.gz) files are also permitted). Small example inputs are included with the package.

A complete file can be denoised in a single line of R code, simply specify the input and output files. When processing fastq files, debar preserves the phred scores.

Note: running the following example will generate an output file in your current working directory!

#gzipped fastq
gzfastq_example_file = system.file('extdata/coi_sequel_data_subset.fastq.gz', package = 'debar')

denoise_file(gzfastq_example_file, outfile = "example_output.fastq")

If you are planning on utilizing debar for large input files, please consult the package vignette section 'Parameter combinations - speed and accuracy trade-offs' for suggestions on how to optimize performance when scaling to tens or hundreds of thousands of sequences.

Version Notes

Initial design and default parameters are based on using debar to process the circular consensus sequences of single molecule real-time (SMRT) sequencing outputs produced by the Pacific Biosciences SEQUEL platform. Despite this, the package is designed to interface with fastq or fasta files of any origin (although the developers have yet to quantify performance on other data sources). In the future we hope to quantify performance and provide informed hyper-parameter choices for outputs from other sequencing platforms. If you are interested in beta testing debar on barcode or metabarcode data from other platforms, please contact Cam, we would be happy to work with you to optimize debar's functionality for other sequencing platforms.

Citation

If you use debar in your research, please consider citing the following publication:

Nugent CM, Elliott TA, Ratnasingham S, Hebert PD, Adamowicz SJ. Debar: A sequence‐by‐sequence denoiser for COI‐5P DNA barcode data. Molecular Ecology Resources. 2021 Nov;21(8):2832-46.

Acknowledgements

Funding for the development of this software was provided by grants in Bioinformatics and Computational Biology from the Government of Canada through Genome Canada and Ontario Genomics and from the Ontario Research Fund. Funders played no role in the study design or preparation of this software.

debar's People

Contributors

cnuge avatar

Stargazers

 avatar

Watchers

 avatar  avatar

Forkers

nadin1123 olivroy

debar's Issues

fastq in and output produces a fastq with a longer phred score line than actual bases

Hi,
I was using debar on my fastq file with the input and output (default) as fastq.
Later, I wanted to process the file further with usearch (dereplication) but it says
---Fatal error--- Bad FASTQ record: 418 bases, 493 quals line 152 file XX.fq label AA

I looked up the label and the bases
@AA AATAAATAATATGAGATTTTGACTTTTACCTCCTGCTTTAACATTGCTGCTAACTAGCAGCATAGTAGAAACTGGAGCTGGAACAGGATGAACTGTTTAC CCCCCACTATCATCTAATATTGCTCATGGAGGAGCCTCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCAGGAATCTCCTCTCTTCTAGGAGCCGTAA ATTTTATTACAACTGTAATTAATATACGATCAATAGGAATTACATTCGATCGCATACCTTTATTTGTATGATCAGTAGTAATTACAGCTTTATTATTACT TTTATCATTACCTGTTTTAGCAGGAGCTATTACAATATTATTGACAGATCGAAATTTAAATACATCTTTTTTTGACCCTGCAGGAGGAGGAGATCCAGTA TTATACCAGCATTTATTT + .... .... AGH:HFAFGGHG=GHGGA@AA
There seems to be a case where the label is not written in a new line?
I'm continuing with outformat ="fasta"

Expected proportion of discarded sequences

Hey,
Out of curiosity I tried debar on 418bp COI sequences (Illumina reads)... so far with little success.
Out of 41.653 sequences 41.580 survived denoising with debar.

Are you planning to make your tool useable for the 418bp sequence as well?

Thanks in advance

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.