Code Monkey home page Code Monkey logo

Comments (6)

MaxGreil avatar MaxGreil commented on August 25, 2024 1

@padix-key I will have a look at the remaining classes

from biotite.

padix-key avatar padix-key commented on August 25, 2024

Good point. How do you imagine the __repr__ strings for Biotite objects?

For sequences I suggest for example NucleotideSequence("ACTAGCTAGCTAGCTAGCTAGCTA", ambiguous=False).

For AtomArray/AtomArrayStack objects, a full representation could look like

array([
    Atom(array([1.0, 2.0, 3.0]), chain_id="A", res_id=1, ...),
    ...
])

However, this might become quite a long string for larger structures. An alternative could be

AtomArray(
    coord = array(
        [[1.0, 2.0, 3.0],
         [4.0, 5.0, 6.0]]
    ),
    chain_id = array(
        ["A", "A"]
    )
)

which would be clearer in my opinion, but has the disadvantage, that this is not valid expression for creating an AtomArray.

from biotite.

Gizzio avatar Gizzio commented on August 25, 2024

I think the first for AtomArray is more intuitive.
As for sequences, I agree with your proposition.

from biotite.

freezer3 avatar freezer3 commented on August 25, 2024

I agree with Gizzio, such a method would be very helpful in my analysis

from biotite.

MaxGreil avatar MaxGreil commented on August 25, 2024

After talking to @padix-key , this would be the target classes (for now):

Sequence subpackage:

  • NucleotideSequence
  • ProteinSequence
  • GeneralSequence
  • Alphabet
  • LetterAlphabet
  • CodonTable
  • Alignment
  • SubstitutionMatrix
  • Location
  • Feature
  • Annotation
  • AnnotatedSequence

Structure subpackage:

  • Atom
  • AtomArray
  • AtomArrayStack

I will have a look at it.

from biotite.

padix-key avatar padix-key commented on August 25, 2024

I reopened the issue, as the closing PR #299 from @MaxGreil only covered only a part of the classes listed above.

from biotite.

Related Issues (20)

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.