Comments (6)
@padix-key I will have a look at the remaining classes
from biotite.
Good point. How do you imagine the __repr__
strings for Biotite objects?
For sequences I suggest for example NucleotideSequence("ACTAGCTAGCTAGCTAGCTAGCTA", ambiguous=False)
.
For AtomArray
/AtomArrayStack
objects, a full representation could look like
array([
Atom(array([1.0, 2.0, 3.0]), chain_id="A", res_id=1, ...),
...
])
However, this might become quite a long string for larger structures. An alternative could be
AtomArray(
coord = array(
[[1.0, 2.0, 3.0],
[4.0, 5.0, 6.0]]
),
chain_id = array(
["A", "A"]
)
)
which would be clearer in my opinion, but has the disadvantage, that this is not valid expression for creating an AtomArray
.
from biotite.
I think the first for AtomArray
is more intuitive.
As for sequences, I agree with your proposition.
from biotite.
I agree with Gizzio, such a method would be very helpful in my analysis
from biotite.
After talking to @padix-key , this would be the target classes (for now):
Sequence subpackage:
- NucleotideSequence
- ProteinSequence
- GeneralSequence
- Alphabet
- LetterAlphabet
- CodonTable
- Alignment
- SubstitutionMatrix
- Location
- Feature
- Annotation
- AnnotatedSequence
Structure subpackage:
- Atom
- AtomArray
- AtomArrayStack
I will have a look at it.
from biotite.
I reopened the issue, as the closing PR #299 from @MaxGreil only covered only a part of the classes listed above.
from biotite.
Related Issues (20)
- Make `flower` color scheme the default
- Failed to deserialize category 'entity' with ValueError: No closing quotation HOT 3
- Issue retrieving residue info for 3UQ HOT 2
- Passing empty array leads to malformed PDBx file
- Adopt a code formatter and linter HOT 3
- Enable use of specific local CCD version HOT 2
- [BUG] Biotite's bond inference seems broken for some structures with specific insertion codes HOT 3
- get_structures not returning extra fields HOT 2
- PubChem throttle control does not properly work
- Add chain id specifier to pdbx.get_sequence HOT 3
- Custom annotations do not appear in Atom `__repr__()` HOT 1
- biotite 0.41.1 `.whl` not available for MacOS ARM HOT 4
- Biotite dssp not running! Subprocess error: code 6 HOT 8
- Indexing BondList with inverse slice does not preserve order
- Implementing TRR/XTC/NetCDF/DCD support w/o MDTraj HOT 6
- Removal of deprecated functionalities HOT 2
- Road to Biotite 1.0
- Adding more tutorials HOT 2
- `DsspApp` is not usable with more recent `mkdssp` versions
- Metal coordination is not reflected in `BondList`
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from biotite.