padix-key Goto Github PK
Name: Patrick Kunzmann
Type: User
Company: VantAI
Bio: Molecular biotechnologist. Python & pun lover. AACGAAGTGGAACGCGGCCAGAACAACGCGGGCATTGTGGAATATCAGGTGGTGCCG
Location: Göttingen, Germany
Name: Patrick Kunzmann
Type: User
Company: VantAI
Bio: Molecular biotechnologist. Python & pun lover. AACGAAGTGGAACGCGGCCAGAACAACGCGGGCATTGTGGAATATCAGGTGGTGCCG
Location: Göttingen, Germany
A conda-smithy repository for ammolite.
Official git repository for Biopython (converted from CVS)
A comprehensive library for computational molecular biology
A conda-smithy repository for biotite.
A conda-smithy repository for conda-forge-pinning.
CWL repository for the GROMACS software
The most widely used Python to C compiler
A high performance drop-in replacement for Biotite's PDBFile.
Generated color schemes for sequence alignment visualizations
A conda-smithy repository for gecos.
Test repository for reproducing Mamba issue in GitHub actions
Adding hydrogens to molecular models
A conda-smithy repository for hydride.
Desktop/Android/HTML5/iOS Java game development framework
An open library for the analysis of molecular dynamics trajectories
A machine learning based protein disorder predictor.
Addon and nodes for working with structural biology and molecular data in Blender.
A collection of error messages returned by NCBI Entrez
OpenMM is a toolkit for molecular simulation using high performance GPU code.
A Python Package for Protein Dynamics Analysis
A conda-smithy repository for pymol-open-source.
A small repository for issue reproduction
The official sources for the RDKit library
⚛️ RDKit Python Wheels on PyPI. 💻 pip install rdkit
Single-cell analysis in Python. Scales to >1M cells.
https://www.sc-best-practices.org
This is the development home of the workflow management system Snakemake. For general information, see
Sphinx extension for automatic generation of an example gallery
Investigate molecular dynamics with elastic network models
A Python module that simply converts pasted spreadsheet data into a numpy array
A declarative, efficient, and flexible JavaScript library for building user interfaces.
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google ❤️ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.