alshai / leviosam Goto Github PK
View Code? Open in Web Editor NEWLift-over alignments from variant-aware references
License: MIT License
Lift-over alignments from variant-aware references
License: MIT License
For each alignment, optionally write it in a FASTQ file (or a pair of) if the MAPQ of it is below a given cutoff. If this option gets activated, don't write low-MAPQ alignments to the lifted BAM output.
Hello,
The documentation does not list the SA flag as lifted, and from reading the code I think that it is indeed not the case. Could you confirm this?
Is this a development you are considering? I guess the logic would be fairly similar to ChainMap::lift_segment, would it not?
Thanks and best regards,
Daniel Naro
Switch to the bcftools v1.11 (especially for bcftools consensus
) logic in levioSAM serialize
when dealing with overlapping variants. LevioSAM is developed base on some logic between bcftools v1.9 and v1.10, but sadly it is no longer the official logic right now.
$bcftools view -H wg-maj.vcf.gz chr20:5099236-5099250
chr20 5099236 . C A
chr20 5099236 . CAATCAATCAATA C
chr20 5099240 . C A
chr20 5099244 . C A
$samtools faidx wg-maj.chr20.v1_11.fa chr20:5099100-5099500
>chr20:5099100-5099500
TGTCTCAAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAATAAATAA
AAAAACCAAATCATTTGGTTGGCCAAAACCTTCTGATCTGAGCTTTGCTCGGCAACCACT
CTCCAAGATAAAGCTTTATGTATCACCTCACATATTCACTGTCAAGGCTCAGGCACTCTA
GATTACTGGACTCCCCAGTCAACATTCCCATTACCAAAAGTCCCTAATCTTGGAGGCTGC
TTCAGGTCACCCTCTCTTTGTCCCTCACTTCCTGAGTTTTTTTTTTTTCCTCCAACTATA
CTCACTCTACTGGTGATCTCAAACAGCCCTCTAGCTTTTAAGATACTGTCCAAATGCTGA
CTCCCAAATTTCTATTTCCATCCAAGACCCACTCTTAAACT
The 11-bp deletion (CAATCAATCAATA>C) is not updated here.
$samtools faidx wg-maj.chr20.v1_9_206_g4694164.fa chr20:5099100-5099500
>chr20:5099100-5099500
TGTCTCAAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATA
AATAATAAATAAAAAAACCAAATCATTTGGTTGGCCAAAACCTTCTGATCTGAGCTTTGC
TCGGCAACCACTCTCCAAGATAAAGCTTTATGTATCACCTCACATATTCACTGTCAAGGC
TCAGGCACTCTAGATTACTGGACTCCCCAGTCAACATTCCCATTACCAAAAGTCCCTAAT
CTTGGAGGCTGCTTCAGGTCACCCTCTCTTTGTCCCTCACTTCCTGAGTTTTTTTTTTTT
CCTCCAACTATACTCACTCTACTGGTGATCTCAAACAGCCCTCTAGCTTTTAAGATACTG
TCCAAATGCTGACTCCCAAATTTCTATTTCCATCCAAGACC
This includes changing CIGAR and trimming corresponding SEQ and QUAL bases.
Hello! Reading the documentation, it didn't seem like there was anything written about the use of phased vs. unphased VCFs. Is levioSAM capable of taking in unphased VCFs to perform lift overs?
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.