Comments (6)
Lioscro
commented on June 13, 2024
1
I see you've been referring to the R tutorial!
Unfortunately, I was not involved in writing this up, so I am not sure what may be happening.
One thing you could try is building the index using kb ref, instead of R directly.
I haven't encountered any issues going with this approach of building the index.
Since you are building an index for RNA velocity, here is an example of a command (for mouse).
kb ref -i index.idx -g t2g.txt -f1 cdna.fa -f2 intron.fa -c1 cdna_t2c.txt -c2 intron_t2c.txt --workflow lamanno -n 8 \
Mus_musculus.GRCm38.dna.primary_assembly.fa.gz \
Mus_musculus.GRCm38.98.gtf.gz
You can also refer to the tutorial here: https://colab.research.google.com/github/pachterlab/kallistobustools/blob/master/notebooks/kb_velocity_index.ipynb
from kb_python.
Lioscro
commented on June 13, 2024
Hi, @kaizen89
Could you post the command you used to generate the index, as well as where you downloaded the FASTA and GTF?
from kb_python.
kaizen89
commented on June 13, 2024
Hi @Lioscro , I followed this tutorial . Replacing only the mouse genome and annotation with human ones.
from kb_python.
kaizen89
commented on June 13, 2024
Hi @Lioscro , unfortunately I still get similar error. I tried to use the index found here but there is an error at the end.
time kb count --h5ad -i index.idx -g transcripts_to_genes.txt -x 10xv3 -o SRR12603789 -c1 cdna_transcripts_to_capture.txt -c2 intron_transcripts_to_capture.txt --lamanno /mnt/sda3/data/public_data/fastq/SRR12603789/SRR12603789_S1_L001_R1_001.fastq.gz /mnt/sda3/data/public_data/fastq/SRR12603789/SRR12603789_S1_L001_R2_001.fastq.gz
[2021-02-19 20:56:06,115] WARNING The `--lamanno` and `-`-n`ucleus` flags are deprecated. These options will be removed in a future release. Please use `--workflow lamanno` or `--workflow nucleus` instead.
[2021-02-19 20:56:06,115] INFO Using index index.idx to generate BUS file to SRR12603789 from
[2021-02-19 20:56:06,115] INFO /mnt/sda3/data/public_data/fastq/SRR12603789/SRR12603789_S1_L001_R1_001.fastq.gz
[2021-02-19 20:56:06,115] INFO /mnt/sda3/data/public_data/fastq/SRR12603789/SRR12603789_S1_L001_R2_001.fastq.gz
[2021-02-19 21:14:32,501] ERROR
[index] k-mer length: 31
[index] number of targets: 845,338
[index] number of k-mers: 271,648,279
[index] number of equivalence classes: 4,776,424
[quant] will process sample 1: /mnt/sda3/data/public_data/fastq/SRR12603789/SRR12603789_S1_L001_R1_001.fastq.gz
/mnt/sda3/data/public_data/fastq/SRR12603789/SRR12603789_S1_L001_R2_001.fastq.gz
[quant] finding pseudoalignments for the reads ... done
[quant] processed 819,658,242 reads, 0 reads pseudoaligned[~warn] no reads pseudoaligned.
[2021-02-19 21:14:32,501] ERROR An exception occurred
Traceback (most recent call last):
File "/home/salmon/.local/lib/python3.6/site-packages/kb_python/main.py", line 837, in main
COMMAND_TO_FUNCTION[args.command](parser, args, temp_dir=temp_dir)
File "/home/salmon/.local/lib/python3.6/site-packages/kb_python/main.py", line 218, in parse_count
temp_dir=temp_dir
File "/home/salmon/.local/lib/python3.6/site-packages/kb_python/count.py", line 1510, in count_velocity
fastqs, index_paths[0], technology, out_dir, threads=threads
File "/home/salmon/.local/lib/python3.6/site-packages/kb_python/validate.py", line 112, in inner
results = func(*args, **kwargs)
File "/home/salmon/.local/lib/python3.6/site-packages/kb_python/count.py", line 149, in kallisto_bus
run_executable(command)
File "/home/salmon/.local/lib/python3.6/site-packages/kb_python/dry/__init__.py", line 24, in inner
return func(*args, **kwargs)
File "/home/salmon/.local/lib/python3.6/site-packages/kb_python/utils.py", line 233, in run_executable
raise sp.CalledProcessError(p.returncode, ' '.join(command))
subprocess.CalledProcessError: Command '/home/salmon/.local/lib/python3.6/site-packages/kb_python/bins/linux/kallisto/kallisto bus -i index.idx -o SRR12603789 -x 10xv3 -t 8 /mnt/sda3/data/public_data/fastq/SRR12603789/SRR12603789_S1_L001_R1_001.fastq.gz /mnt/sda3/data/public_data/fastq/SRR12603789/SRR12603789_S1_L001_R2_001.fastq.gz' returned non-zero exit status 1.
real 18m27,371s
user 19m42,208s
sys 0m12,165s
from kb_python.
kaizen89
commented on June 13, 2024
@Lioscro After trying other fastq files it appears the problem is not coming from kb but from the fastqs. I downloaded these files as SRR12603789_1.fastq.gz and SRR12603789_2.fastq.gz which I renamed as SRR12603789_S1_L001_R1_001.fastq.gz and SRR12603789_S1_L001_R2_001.fastq.gz.
Other fastqs are not giving any error.
zcat HESA03_HSB42I_0_G_S17_L001_R2_001.fastq.gz | head
@A00213:234:HT3JKDMXX:1:1101:30617:1000 2:N:0:NTGTTTCC
TATTATCGAAACCATCAGCCTGCTCATTCAACCAATAGCCCTAGCCGTACGCCTAACCGCT
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFF,FFFFFFFFFFF:FFFFFF
@A00213:234:HT3JKDMXX:1:1101:31340:1000 2:N:0:NTGTTTCC
AAGCAGTGGTATCAACGCAGAGTACATGGGGAGAGTAAAAAAAAAAAAACACAGAAGAGAG
+
FFFFFF,FFF,FFFFFFF,,FFFFFFFFFFF,FFFFF:FFFF:F,FFFFFFF::FFFFFFF
@A00213:234:HT3JKDMXX:1:1101:32353:1000 2:N:0:NTGTTTCC
GGCATCTCTTGTGTACTTATTGTTTAAGGTTTCCTCAAACTGTGATTTTTCTGAACACAAT
However this one gives the error
zcat /mnt/sda3/data/public_data/fastq/SRR12603789/SRR12603789_S1_L001_R2_001.fastq.gz | head
@SRR12603789.1 1/2
CACTCCAGTGCTCAGCTTGCACCCTGGCACAGGCCAGCAGTTGCTGGAAGTCAGACACCTGCAGATGAAGACCACAGCATCAAGACCCTGTGACCTCTCAAAGGCCCGGTGGAAAGGACACGGGAAGTCTGGGCTAAGAGACAGCAAATA
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFF:FFFFFFFFFFFFFFFF:FFFFFF:
@SRR12603789.2 2/2
ATCCCACTCTAGGCATGGCTCCTCTCCACAGGAAAACTCCACTCCAGTGCTCAGCTTGCACCCTGGCACAGGCCAGCAGTTGCTGGAAGTCAGACACCTGCAGATGAAGACCACAGCATCAAGACCCTGTGACCTCTCAAAGGCCCGGTG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFF
@SRR12603789.3 3/2
CAATGGCCCATCCCACTCTAGGCATGGCTCCTCTCCACAGGAAAACTCCACTCCAGTGCTCAGCTTGCACCCTGGCACAGGCCAGCAGTTGCTGGAAGTCAGACACCTGCAGATGAAGACCACAGCATCAAGACCCTGTGACCTCTCAAA
Both samples have been processed with cellranger and velocyto.py without issues
Could you please have a look at the last file and tell me if you see something wrong with it?
Thank you
from kb_python.
kaizen89
commented on June 13, 2024
Turns out contrary to what was mentioned in the paper, the tech used is v2 and not v3. No error when correcting this.
from kb_python.
Related Issues (20)
- Is kb-python capable of processing many samples in one command? HOT 2
- --umi-gene no longer supported in kb count? HOT 2
- Containerized kb can choose the wrong binary HOT 1
- How to run RNA velocity analysis (La Manno) on BAM files HOT 4
- kb-python processing significantly less reads HOT 6
- Crosspost from kallistobustools: kb count error with CSP reads HOT 21
- Running kb count with a single FASTQ file HOT 4
- kb count - joint vs individual sample processing for RNA velocity analysis HOT 2
- kb ref can't handle blanks in path arguments HOT 2
- Naive collapsing of UMIs in SS3xpress data? HOT 6
- No reads pseudoaligned in 10XV1 chemistry HOT 6
- Usage of f1 and f2 parameters in kb ref and count HOT 2
- Changed barcodes from the kb-python count HOT 2
- Issue obtaining unaligned reads HOT 3
- Kb count command stuck on bustools count step HOT 5
- kb-python for MARS-seq HOT 2
- Syntax for 3-reads, paired end technology? HOT 3
- Whitelist for SMARTSEQ2 technology HOT 6
- kb count long run time (run seems stuck) HOT 2
- Fatal error LNK 1181 when trying to install kb-python on Windows 10 system
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from kb_python.