Comments (4)
The second column in the output corresponds to acceptor probabilities for each position, and the third corresponds to donor probabilities. In this case, the model is saying that the input sequence doesn't splice.
from spliceai.
how would an example w/ a splice site look like? which scores would you expect (the ones in the 2nd/ 3rd column seem "small" already ...)
from spliceai.
Suppose we use this sequence 'CGATCTGACGTGGGTGTAGGTAAGTGCATTATCGATATTGCAT' (I have planted a donor motif around the middle), you get this output:
array([[[9.99985993e-01, 1.40094662e-05, 7.43200417e-08],
[9.99981284e-01, 1.81920605e-05, 4.59646884e-07],
[9.99959588e-01, 4.04304556e-05, 9.72240031e-08],
[9.99997914e-01, 1.81026769e-06, 2.11512273e-07],
[9.99981105e-01, 1.87257538e-05, 1.84678086e-07],
[9.99997616e-01, 2.22162589e-06, 1.58002280e-07],
[9.99976337e-01, 2.32699349e-05, 3.86139988e-07],
[9.99968171e-01, 3.15743491e-05, 2.48222989e-07],
[9.99869466e-01, 2.05758897e-05, 1.09932516e-04],
[9.99990284e-01, 8.31942270e-06, 1.38772452e-06],
[9.99941647e-01, 5.70513548e-05, 1.33313620e-06],
[9.99996543e-01, 2.48335687e-06, 9.24738913e-07],
[9.99904454e-01, 3.52658608e-05, 6.02765722e-05],
[9.99976814e-01, 2.26476441e-05, 5.33687967e-07],
[9.98460770e-01, 3.49480324e-05, 1.50430272e-03],
[9.99996006e-01, 3.18197226e-06, 7.64729862e-07],
[9.99990106e-01, 8.76577269e-06, 1.17254172e-06],
[9.99990821e-01, 6.36481946e-06, 2.79536471e-06],
[6.46120489e-01, 8.37011263e-04, 3.53042454e-01],
[9.99608636e-01, 3.86872416e-04, 4.51662299e-06],
[9.99994636e-01, 3.63963477e-06, 1.67586336e-06],
[9.99996066e-01, 1.63950494e-06, 2.23818938e-06],
[9.99969482e-01, 5.67788311e-06, 2.48165161e-05],
[9.99998391e-01, 1.49879145e-06, 1.63973709e-07],
[9.99952912e-01, 4.61158597e-05, 1.05664662e-06],
[9.99996006e-01, 3.80371307e-06, 2.04130629e-07],
[9.99997735e-01, 2.14823740e-06, 1.33420997e-07],
[9.99997497e-01, 2.08130041e-06, 4.22661458e-07],
[9.99998868e-01, 1.14169552e-06, 4.58909710e-08],
[9.99998093e-01, 1.14678699e-06, 7.67544975e-07],
[9.99999642e-01, 2.47565538e-07, 7.65863177e-08],
[9.99999225e-01, 7.40523660e-07, 2.01556567e-08],
[9.99994457e-01, 5.47419040e-06, 5.00959274e-08],
[9.99996185e-01, 3.27182170e-06, 6.35605090e-07],
[9.99997258e-01, 2.72508942e-06, 3.42512507e-08],
[9.99999166e-01, 8.44390911e-07, 3.03123286e-08],
[9.99998093e-01, 1.89125274e-06, 1.63006373e-08],
[9.99999702e-01, 3.21699702e-07, 9.29854238e-09],
[9.99999821e-01, 2.41913938e-07, 1.15190559e-08],
[9.99999404e-01, 6.25196776e-07, 8.32780334e-09],
[9.99997973e-01, 2.00116369e-06, 1.19149473e-08],
[9.99995232e-01, 4.75768866e-06, 1.50998183e-08],
[9.99999642e-01, 3.18003885e-07, 2.90503799e-08]]], dtype=float32)
FYI, you can use the vectors acceptor_prob and donor_prob instead of y.
from spliceai.
perfect thanks a lot!
from spliceai.
Related Issues (20)
- Interpret SpliceAI result
- Lower Accuracy Than Introme HOT 1
- Training with additional Batch Normalization layer producing strange results HOT 1
- Trouble to launch SpliceAI with grch37 HOT 5
- spliceAI not giving output value while running using vep (Variant Ensemble Predictor) HOT 3
- Position of splice sites within an insertion HOT 1
- Training input shape HOT 1
- Question about using snv and indel score files
- variant not scored HOT 5
- Running SpliceAI takes too much time
- Duplicate records in the released VCF file HOT 3
- Unable to install using conda install HOT 1
- Running Short Tandem Repeat genotypes
- build-in grch38 annotation
- How to make a custom annotation set? HOT 2
- No training configuration found in the save file, so the model was *not* compiled. Compile it manually. HOT 3
- spliceai score HOT 3
- Query about spliceai to calculate Delins HOT 1
- WARNING:root:Skipping record (ref too long)
- Way to many TEMP files
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from spliceai.