Code Monkey home page Code Monkey logo

Comments (9)

GoogleCodeExporter avatar GoogleCodeExporter commented on September 26, 2024
need to attach some data or else i can't debug/fix this.  when i try to 
simulate the issue, everything works fine.

Original comment by [email protected] on 3 Sep 2014 at 8:53

from ea-utils.

GoogleCodeExporter avatar GoogleCodeExporter commented on September 26, 2024
(probably like 10 or so reads + adatpors.fa you are using)

Original comment by [email protected] on 3 Sep 2014 at 8:53

from ea-utils.

GoogleCodeExporter avatar GoogleCodeExporter commented on September 26, 2024
Here's what I just tried on Ubuntu 14.04 ... worked fine.   So it's not a 
trivial case.

Scale used: 2.2
Phred: 64
Threshold used: 1 out of 4
Adapter 3p_for_test (CATGATTGATGGTGCCTACAG): counted 4 at the 'start' of 
'test5.fq', clip set to 1
Files: 1

---cut---
@1
CATGATTGATGGTGCCTACAGATCAGCTAGGCATCGATATATCGATCGGCTAGAGATATACGATCGAT
+
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@2
CATGATTGATGGTGCCTACAGATCAGCTAGGCATCGATATATCGATCGGCTAGAGATATACGATCGAG
+
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@3
CATGATTGATGGTGCCTACAGATCAGCTAGGCATCGATATATCGATCGGCTAGAGATATACGATCGAG
+
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@4
CATGATTGATGGTGCCTACAGATCAGCTAGGCATCGATATATCGATCGGCTAGAGATATACGATCGAC
+
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh

Original comment by [email protected] on 3 Sep 2014 at 9:18

from ea-utils.

GoogleCodeExporter avatar GoogleCodeExporter commented on September 26, 2024
also, i fixed the makefile so you don't need to make sparsehash first

Original comment by [email protected] on 3 Sep 2014 at 9:19

from ea-utils.

GoogleCodeExporter avatar GoogleCodeExporter commented on September 26, 2024
Apologies - please find attached the adaptors.fa and the first 10 reads of the 
fastq file that I am using.  I verified that I am still seeing the same problem 
with the cut down file.

If you want to play with the whole file, it is available in the NCBI sequence 
read archive - the accession number is the file name.

I have seen this problem with every file I have tried, including test examples 
similar to yours above so I am wondering if it is something screwy with my 
installation of 14.04 - I can't think what though as it is a standard 
installation and up to date, and I didn't see any unusual warnings or anything 
when compiling on 14.04.  If it makes any difference, all the installations of 
Ubuntu I am testing here have 64-bit architecture.

Original comment by [email protected] on 4 Sep 2014 at 9:16

Attachments:

from ea-utils.

GoogleCodeExporter avatar GoogleCodeExporter commented on September 26, 2024
ok! i can reproduce this on a 64-bit virtualbox... i had to update my bios, 
enable hardware acceleration, and update the number of cores to get it to 
break.   i added a new test for it, which nicely passes under other 
versions/instances of ubuntu

Original comment by [email protected] on 4 Sep 2014 at 3:09

from ea-utils.

GoogleCodeExporter avatar GoogleCodeExporter commented on September 26, 2024
Ha ha!  Yes, the 14.04 machine is less than a year old, and has 8 cores.  Maybe 
I should just trim on my laptop instead! Glad you have reproduced the problem - 
I was beginning to think that I was just doing something stupid :-)

Original comment by [email protected] on 4 Sep 2014 at 3:21

from ea-utils.

GoogleCodeExporter avatar GoogleCodeExporter commented on September 26, 2024
This has been fixed.   I deprecated the 780 release, and added a new release 
806, which has a) the fix and b) the test for the fix.

Original comment by [email protected] on 4 Sep 2014 at 3:47

  • Changed state: Fixed

from ea-utils.

GoogleCodeExporter avatar GoogleCodeExporter commented on September 26, 2024
Great, thanks!

Original comment by [email protected] on 4 Sep 2014 at 4:06

from ea-utils.

Related Issues (20)

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.