From the error trace it's not clear to me what went wrong. Can you share
the input files with me or is it confidential data?

Tobias

On Tue, May 13, 2014 at 11:24 AM, Jan van Haarst
[email protected]:

I have problems getting Delly to analyse my sample, with type "TRA" :

(I have removed the output above, as that doesn't seem to relate to the problem)
[pid 22642] read(4, "GCACTTTCTATCTC\nGGAAACCTTTCAACTAA"..., 16384) = 16384
[pid 22642] read(4, "GAAAGTTGGAGTTTTTCAGCGTTTGCGTTCCA"..., 16384) = 16384
[pid 22642] write(1, "", 1) = 1
[pid 22642] write(1, "", 1) = 1
[pid 22642] write(1, "", 1) = 1
[pid 22642] futex(0x2b1cbaa451b0, FUTEX_WAKE_PRIVATE, 2147483647) = 0
[pid 22642] write(2, "terminate called after throwing "..., 48terminate called after throwing an instance of ') = 48
[pid 22642] write(2, "std::length_error", 17std::length_error) = 17
[pid 22642] write(2, "'\n", 2'
) = 2
[pid 22642] write(2, " what(): ", 11 what(): ) = 11
[pid 22642] write(2, "basic_string::_S_create", 23basic_string::_S_create) = 23
[pid 22642] write(2, "\n", 1
) = 1
[pid 22642] rt_sigprocmask(SIG_UNBLOCK, [ABRT], NULL, 8) = 0
[pid 22642] tgkill(22642, 22642, SIGABRT) = 0
[pid 22642] --- SIGABRT {si_signo=SIGABRT, si_code=SI_TKILL, si_pid=22642, si_uid=1005} ---
[pid 22642] +++ killed by SIGABRT (core dumped) +++
<... wait4 resumed> [{WIFSIGNALED(s) && WTERMSIG(s) == SIGABRT && WCOREDUMP(s)}], 0, NULL) = 22642
open("/usr/share/locale/locale.alias", O_RDONLY|O_CLOEXEC) = 3
fstat(3, {st_mode=S_IFREG|0644, st_size=2570, ...}) = 0
mmap(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0x2af29506d000
read(3, "# Locale name alias data base.\n#"..., 4096) = 2570
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [CHLD], 8) = 0
brk(0x214b000) = 0x214b000
rt_sigprocmask(SIG_SETMASK, [CHLD], NULL, 8) = 0
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [CHLD], 8) = 0
brk(0x214c000) = 0x214c000
rt_sigprocmask(SIG_SETMASK, [CHLD], NULL, 8) = 0
read(3, "", 4096) = 0
close(3) = 0
munmap(0x2af29506d000, 4096) = 0
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [CHLD], 8) = 0
rt_sigprocmask(SIG_SETMASK, [CHLD], NULL, 8) = 0
open("/usr/share/locale/en_US/LC_MESSAGES/bash.mo", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/share/locale/en/LC_MESSAGES/bash.mo", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/share/locale-langpack/en_US/LC_MESSAGES/bash.mo", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/share/locale-langpack/en/LC_MESSAGES/bash.mo", O_RDONLY) = -1 ENOENT (No such file or directory)
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [CHLD], 8) = 0
rt_sigprocmask(SIG_SETMASK, [CHLD], NULL, 8) = 0
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [CHLD], 8) = 0
rt_sigprocmask(SIG_SETMASK, [CHLD], NULL, 8) = 0
open("/usr/share/locale/en_US/LC_MESSAGES/libc.mo", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/share/locale/en/LC_MESSAGES/libc.mo", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/share/locale-langpack/en_US/LC_MESSAGES/libc.mo", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/share/locale-langpack/en/LC_MESSAGES/libc.mo", O_RDONLY) = -1 ENOENT (No such file or directory)
write(2, "./run_delly.sh: line 29: 22642 A"..., 152./run_delly.sh: line 29: 22642 Aborted (core dumped) delly --type ${type} --outfile ${type}.vcf --genome $REFERENCE ${LOCATION}/${GLOB}
) = 152
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
--- SIGCHLD {si_signo=SIGCHLD, si_code=CLD_DUMPED, si_pid=22642, si_status=SIGABRT, si_utime=1291884, si_stime=122927} ---
wait4(-1, 0x7fff1a1ef7d8, WNOHANG, NULL) = -1 ECHILD (No child processes)
rt_sigreturn() = 0
rt_sigaction(SIGINT, {0x456570, [], SA_RESTORER, 0x2af2956c9ff0}, {0x43f800, [], SA_RESTORER, 0x2af2956c9ff0}, 8) = 0
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [], 8) = 0
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [], 8) = 0
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [], 8) = 0
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [], 8) = 0
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [], 8) = 0
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [], 8) = 0
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [], 8) = 0
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [], 8) = 0
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [], 8) = 0
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [], 8) = 0
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [], 8) = 0
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [], 8) = 0
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
rt_sigprocmask(SIG_BLOCK, ~[RTMIN RT_1], [], 8) = 0
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
kill(0, SIGTERMProcess 22618 detached
<detached ...>
Terminated

The script I used to generate this :

cat run_delly.sh
#!/bin/bash

Make the script stop if something goes wrong

set -o errexit

Kill all child processes on exit (see http://stackoverflow.com/questions/360201/kill-background-process-when-shell-script-exit )

This doesn't remove the temporary directory we create below.

trap "kill 0" SIGINT SIGTERM EXIT # with gnu paralell this doesnt work properly, too early a sigterm is recieved.

Debugging

#set -o verbose
#set -o xtrace

#settings and binaries
threads=40

mkdir -p /mnt/nexenta/haars001/projects/yeast_evolution/delly_running && cd $_
export LD_LIBRARY_PATH=/mnt/nexenta/haars001/projects/yeast_evolution/delly/bamtools/lib:$LD_LIBRARY_PATH
export PATH=/mnt/nexenta/haars001/projects/yeast_evolution/delly/delly/src:$PATH
export OMP_NUM_THREADS=$threads

LOCATION=/mnt/nexenta/haars001/projects/yeast_evolution/mapping
REFERENCE=${LOCATION}/S288C_chromosomes_reference_genome_Current_Release.fasta
EXTENSION='.sam.gz.bam.rocksort.bam'
GLOB='Sample_*'${EXTENSION}
SV_TYPE="DEL DUP INV TRA"
SV_TYPE="TRA"

Loop through different types

for type in $SV_TYPE
do
echo $type
delly --type ${type} --outfile ${type}.vcf --genome $REFERENCE ${LOCATION}/${GLOB}
done

The version I used was compiled with debug from this commit:

git log | head
commit e513dca
Merge: 04b6a22 3772d4c
Author: tobiasrausch [email protected]
Date: Fri May 9 10:11:10 2014 +0200

Merge pull request #5 from jvhaarst/patch-1

Point to Heng Li's Github repository of seqtk.

commit 04b6a22

If you need me to run other tests, feel free to ask, I would really like
to run Delly on my data.

—
Reply to this email directly or view it on GitHubhttps://github.com//issues/7
.

from delly.

Unfortunately, that is confidential data.

from delly.

Okay, I see. I just released v0.5.4 where I also fixed one bug in the junction genotyping so maybe this was your problem here but I am not sure.

from delly.

Hi, I ran v0.5.4 and encountered the same error.

from delly.

For me the new version also gave an error:

0%   10   20   30   40   50   60   70   80   90   100%
|----|----|----|----|----|----|----|----|----|----|
***************************************************
[2014-May-22 18:00:17] Junction read annotation

0%   10   20   30   40   50   60   70   80   90   100%
|----|----|----|----|----|----|----|----|----|----|
***********************************terminate called after throwing an instance of 'std::length_error'
  what():  basic_string::_S_create
./run_delly.sh: line 29: 15459 Aborted                 (core dumped) delly --type ${type} --outfile ${type}.vcf --genome $REFERENCE ${LOCATION}/${GLOB}
Terminated

from delly.

Thanks for reporting this. I am currently trying to re-produce this bug but no success so far. If anybody has a small bam file causing such an error and is able to share this bam file, I am very happy to look into this issue.

from delly.

Thanks for getting back. Just running simulated tcga test bams to see if we catch the same error. If we do, I can send a link to the bams.

from delly.

Hi, the simulated bams ran fine, but we tried again on multiple 'real' samples and encountered the same problem. We also use both the binary and the compiled version of 0.5.4 from source code and it didn't make a difference. One of our grad students (Gavin) ran the program in 'debug' mode and found the following error:

It looks like countMapItRight->second is empty when the code expects it to have a value:

(gdb) print countMapItLeft->second.size()
$4 = 1
(gdb) print countMapItRight->second.size()
$5 = 0
(gdb)

I am not sure if a simple check to ensure that the each of those vectors is empty before he uses them or if it indicates that there is another issue with the code. I can try to get more information if the author needs it. I have also included a full backtrace of the crash:

#0  0x000000000042ae32 in std::vector<unsigned short, std::allocator<unsigned short> >::size (this=0x0)
    at /u/gwilson/local/lib/gcc/x86_64-unknown-linux-gnu/4.7.1/../../../../include/c++/4.7.1/bits/stl_vector.h:626
#1  0x000000000043f5d6 in vcfOutput<Config, torali::StructuralVariantRecord, boost::unordered::unordered_map<std::pair<std::string, int>, std::pair<std::vector<unsigned short, std::allocator<unsigned short> >, std::vector<unsigned short, std::allocator<unsigned short> > >, boost::hash<std::pair<std::string, int> >, std::equal_to<std::pair<std::string, int> >, std::allocator<std::pair<std::pair<std::string, int> const, std::pair<std::vector<unsigned short, std::allocator<unsigned short> >, std::vector<unsigned short, std::allocator<unsigned short> > > > > >, boost::unordered::unordered_map<std::pair<std::string, int>, std::pair<int, int>, boost::hash<std::pair<std::string, int> >, std::equal_to<std::pair<std::string, int> >, std::allocator<std::pair<std::pair<std::string, int> const, std::pair<int, int> > > >, boost::unordered::unordered_map<std::pair<std::string, int>, std::vector<std::vector<unsigned short, std::allocator<unsigned short> >, std::allocator<std::vector<unsigned short, std::allocator<unsigned short> > > >, boost::hash<std::pair<std::string, int> >, std::equal_to<std::pair<std::string, int> >, std::allocator<std::pair<std::pair<std::string, int> const, std::vector<std::vector<unsigned short, std::allocator<unsigned short> >, std::allocator<std::vector<unsigned short, std::allocator<unsigned short> > > > > > >, torali::TranslocationTag> (c=..., svs=..., jctCountMap=..., readCountMap=..., normalCountMap=...,
    abnormalCountMap=..., svType=...) at src/delly.cpp:1222
#2  0x000000000041e50f in run<torali::SVType<torali::TranslocationTag> > (c=..., svType=...) at src/delly.cpp:2220
#3  0x0000000000402027 in main (argc=9, argv=0x7fffffffe168) at src/delly.cpp:2317

Getting you real bams is possible but painful. Let me know and we can initiate a process to get you access if required. Thanks for your help.

from delly.

Thanks, the gdb backtrace was very helpful. I hopefully fixed this bug now and updated delly to v0.5.5. Let me know if you still run into problems. Many thanks again to both of you for helping to debug this issue.

from delly.

Thanks. Will give it a shot.

from delly.

Just tried an analysis with v0.5.5 , and got this:

[2014-Jul-03 13:04:23] ./delly --type TRA --outfile TRA.Parent_W24.sort.bam.vcf --genome /mnt/nexenta/haars001/projects/yeast_evolution/mapping/S288C_chromosomes_reference_genome_Current_Release.fasta /mnt/nexenta/haars001/projects/yeast_evolution/mapping/Parent_W24.sort.bam
[2014-Jul-03 13:05:11] Paired-end clustering

0%   10   20   30   40   50   60   70   80   90   100%
|----|----|----|----|----|----|----|----|----|----|
***************************************************
[2014-Jul-03 13:05:32] Library statistics
Sample: Parent_W24.sort
RG: ID=DefaultLib,Median=486,MAD=130,Orientation=2,InsertSizeCutoff=1136,DuplicateDiscordantPairs=50,UniqueDiscordantPairs=21045
[2014-Jul-03 13:05:32] Split-read alignment

0%   10   20   30   40   50   60   70   80   90   100%
|----|----|----|----|----|----|----|----|----|----|
********./run_delly.sh: line 33: 27333 Segmentation fault      (core dumped) ./delly --type ${type} --outfile ${type}.${BASENAME}.vcf --genome $REFERENCE ${BAM}

I could get you the BAM file, and the reference, just tell me how to get it to you in a relatively secure way.

from delly.