Comments (8)
if_VarDict should be 1, if that variant has PASS and Somatic in the VarDict's vcf file.
from somaticseq.
yes,
the variant info is
chr1 3712588 . G A 103 PASS STATUS=StrongSomatic;SAMPLE=TUMOR;TYPE=SNV;DP=91;VD=12;AF=0.1319;SHIFT3=0;MSI=2.000;MSILEN=2;SSF=0.07143;SOR=0;LSEQ=AGGCTCTGCAGGCGCGGGGC;RSEQ=CAGCGCGCCAGGTCGGCTGG GT:DP:VD:ALD:RD:AD:AF:BIAS:PMEAN:PSTD:QUAL:QSTD:SBF:ODDRATIO:MQ:SN:HIAF:ADJAF:NM 0/1:91:12:5,7:37,42:79,12:0.1319:2,2:38:1:29:1:0.76749:1.23051:60:11:0.131:0.011:1.7 0/0:21:0:0,0:8,13:21,0:0:2,0:36.4:1:33.6:1:1:0:60:9.5:1:0:0.6
but Ensemble.sSNV.tsv has if_VarDict:0
Jeongmin
from somaticseq.
You can send me some of the two files if you don't mind. Include the line in question, plus 10 lines before and after, and also include the headers. You may send them to [email protected].
from somaticseq.
Hi,
i send you file via e-mail.
i think Vardict's 'bed_intersector' step has that problem. because intersect.vardict.vcf has no variant chr1 3712588 i wrote on issues.
Thank you for your helping.
Jeongmin
from somaticseq.
I figure out why. When VarDict outputs things like <DUP>, <DEL>, <INV>, etc. in the VCF file, they do not have END=xxx field in INFO, which is required for bedtools because the END field tells bedtools where the region ends. So bedtools doesn't go into completion. Let me modify my codes to get around that issue.
from somaticseq.
I incorporated the fix into the "latest" branch. Will move that into the main branch when I've tested it more extensively.
from somaticseq.
oh, great!
i hope it will work fine.
Thank you for your helping.
Jeongmin
from somaticseq.
Fixed by including a routine to remove incompatible lines in VarDict's vcf files before using bedtools on it.
from somaticseq.
Related Issues (20)
- Special setting for b37? HOT 14
- Question about simulating somatic mutations HOT 7
- Pretrained Classifier HOT 3
- Docker issue with latest version HOT 1
- SEQC2: Some high confidence SNVs and INDELs in VCF are outside of regions defined by High-Confidence_Regions_v1.2.bed HOT 2
- Somaticseq makeSomaticScripts.py running and output issues HOT 8
- Slow RNA variant calling HOT 8
- Question for the paper on establishing the reference call set HOT 3
- Where are the 10x Genomics single-cell copy number variation (CNV) analysis results? HOT 7
- Ground Truths required for training HOT 1
- somaticseq failing for same command it had previously successfully run HOT 11
- Applying internal filters to outputs before running SomaticSeq HOT 1
- Dockerized alignment workflow does not work with multiple input files HOT 5
- Error when running makeSomaticScripts with multiple threads HOT 3
- Output allele of the normal sample HOT 2
- UnboundLocalError: cannot access local variable 'normal_name' where it is not associated with a value HOT 10
- how to obtain all variants where the "FILTER" column is not labeled as "PASS" HOT 1
- Are multi-nucleotide and complex variants ignored? HOT 2
- Error when running FFPE training data from SEQ2C HOT 5
- AI consensus calling error on WGS samples HOT 9
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from somaticseq.